ORFeome > copg1 ORF1 – XORFeome v1.0

copg1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: copg1
Gene ID: 920005
Gene Page ID: 919992
ORF Xenbase ID: 17270415

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC061661
Original XGC clone length: 2625

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ824762
dbEST ID: 79642464
Trimmed Sequence: ATGCTGAAGAAGTTCGATAAGAAAGATGAGGAGTCTGGGGGCAGCTCCAACCCTTTCCAGAGCCTTGAAAAGAGTGCAGTGCTCCAGGAGGCTCGTCTGTTTAACGAGACTCCGATTAACCCACGAAAATGTGCTCACATCTTGACGAAAATACTATATTTAATAAACCAGGGTGAGCACATGGGTGCAACAAAAGCCACAGAAGCTTTCTTTGCCATGACCAAACTTTTCCAGTCAAATGATCCGACACTCCGCAAAATGTGTTACCTGACTATAAAAGAGATGTCAAGCATTTCTGAGGATGTAATTATTGTAACGAGTAGTTTAACCAAAGATATGACTGGGAAGGATGATGGCTACCGAGGTCCAGCTGTGAGAGCACTCTGCAAAATCACAGATAGCACCATGCTACAGGCTATTGAACGTTACATGAAACAGGCCATAGTAGACAAAGTATCCAGTGTGTCCAGCTCTGCTCTTGTCTCCTCATTGCACCTACTGAAGACCAGTTTTGACGTAGTGAAACGTTGGGTAAATGAGGCCCAAGAAGCAGCTTCCAGTGATAATATAATGGTTCAGTATCATGCTTTGGGACTGCTGTACCACGTGCGAAAAAATGACCGGCTGTCTGTTAACAAGATGTTGAGCAAGTTCATGCGCCATGGTCTGAGGTCCCCCTTTGCCTATTGCATGATGATTCGTGTGGCTAGCAGGCTGCTGGATGAAGAGGATGGAAGTCGGGAAAAGTCCTTTGTTTGATTTTATTGGAGGGGCTGTCTGACAAACAAACATGAAAATGGGTTGGTCTATAAAGTCGGCCTTCCAC
Full Trace Sequence: CAGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGAAGAAGTTCGATAAGAAAGATGAGGAGTCTGGGGGCAGCTCCAACCCTTTCCAGAGCCTTGAAAAGAGTGCAGTGCTCCAGGAGGCTCGTCTGTTTAACGAGACTCCGATTAACCCACGAAAATGTGCTCACATCTTGACGAAAATACTATATTTAATAAACCAGGGTGAGCACATGGGTGCAACAAAAGCCACAGAAGCTTTCTTTGCCATGACCAAACTTTTCCAGTCAAATGATCCGACACTCCGCAAAATGTGTTACCTGACTATAAAAGAGATGTCAAGCATTTCTGAGGATGTAATTATTGTAACGAGTAGTTTAACCAAAGATATGACTGGGAAGGATGATGGCTACCGAGGTCCAGCTGTGAGAGCACTCTGCAAAATCACAGATAGCACCATGCTACAGGCTATTGAACGTTACATGAAACAGGCCATAGTAGACAAAGTATCCAGTGTGTCCAGCTCTGCTCTTGTCTCCTCATTGCACCTACTGAAGACCAGTTTTGACGTAGTGAAACGTTGGGTAAATGAGGCCCAAGAAGCAGCTTCCAGTGATAATATAATGGTTCAGTATCATGCTTTGGGACTGCTGTACCACGTGCGAAAAAATGACCGGCTGTCTGTTAACAAGATGTTGAGCAAGTTCATGCGCCATGGTCTGAGGTCCCCCTTTGCCTATTGCATGATGATTCGTGTGGCTAGCAGGCTGCTGGATGAAGAGGATGGAAGTCGGGAAAAGTCCTTTGTTTGATTTTATTGGAGGGGCTGTCTGACAAACAAACATGAAAATGGGTTGGTCTATAAAGTCGGCCTTCCAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGAAGAAGTTCGATAAGAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ830122
dbEST ID: 79647824
Trimmed Sequence: GCCCACGGAGGCCATGATGACATCGACTGGAAACTCGTCCTTGCTCCGAGCAGTAACCTGCATTGTAACAGTGTCTGTGAGGACCAGTTTGGCTCGTACCAAGATGTCGTGCCCTCCACGAAACACACCTGCTAGGTAGAGACTATGTGCATTCTTGTTTTCTGGCACTTTATCTGATCTCTCGCAGGGCTGCATTCCCAGGAACTTTACAACATTGCCAACGGCCTCTTCTAATGTTTTGATGGTAGATAAGTTGAAAGTTTCTTCTTTATCAAACTCATCTCCCACCTCATCCCACGCTGCACCGAAGTTAGGCTTAAGAATTTTCTGTATGTGATCAGCAACTGTCACCTCAATGTCTTCTAGCACATATTCGTCCTCATACCCTTCCTCATCAGATTCACCGGTATTGGGGTCACAATCTTTAACTGTAAATTTCAGCAAGCAACTGAATGTACATGCCAATGCATTTGGATCCTCCTGAGGAATAGATACCAAGGTATAGCATATGCCAGGCTGGTTGTATGATAGGGCTTTAGCAGGTACACAGCAGATAACTTCATATCCTTCTGTGGGCTCCATCTGTACTGTGACATTCTCCAGTATCTGATCATTCAGGGGTATTGGTGCAATCAAACTGGAACACCATGTGATTTACAAAAGTGTGCCTAGTACAAACCTATGACGTAATCTGTGCTTCAAATTCTGTTAAGGGCCCCAGGGCTCCTGCCGAAGACTTAAAAAAAAGGCCCCAAGTTCTTTTAAAACTCAGA
Full Trace Sequence: CCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCCACGGAGGCCATGATGACATCGACTGGAAACTCGTCCTTGCTCCGAGCAGTAACCTGCATTGTAACAGTGTCTGTGAGGACCAGTTTGGCTCGTACCAAGATGTCGTGCCCTCCACGAAACACACCTGCTAGGTAGAGACTATGTGCATTCTTGTTTTCTGGCACTTTATCTGATCTCTCGCAGGGCTGCATTCCCAGGAACTTTACAACATTGCCAACGGCCTCTTCTAATGTTTTGATGGTAGATAAGTTGAAAGTTTCTTCTTTATCAAACTCATCTCCCACCTCATCCCACGCTGCACCGAAGTTAGGCTTAAGAATTTTCTGTATGTGATCAGCAACTGTCACCTCAATGTCTTCTAGCACATATTCGTCCTCATACCCTTCCTCATCAGATTCACCGGTATTGGGGTCACAATCTTTAACTGTAAATTTCAGCAAGCAACTGAATGTACATGCCAATGCATTTGGATCCTCCTGAGGAATAGATACCAAGGTATAGCATATGCCAGGCTGGTTGTATGATAGGGCTTTAGCAGGTACACAGCAGATAACTTCATATCCTTCTGTGGGCTCCATCTGTACTGTGACATTCTCCAGTATCTGATCATTCAGGGGTATTGGTGCAATCAAACTGGAACACCATGTGATTTACAAAAGTGTGCCTAGTACAAACCTATGACGTAATCTGTGCTTCAAATTCTGTTAAGGGCCCCAGGGCTCCTGCCGAAGACTTAAAAAAAAGGCCCCAAGTTCTTTTAAAACTCAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCCACGGAGGCCATGA