ORFeome > cops2 ORF1 – XORFeome v1.0

cops2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cops2
Gene ID: 954201
Gene Page ID: 954195
ORF Xenbase ID: 17270427

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108778
Original XGC clone length: 1332

Human orthology & disease relationships

NCBI Entrez ID: 9318
Ensembl gene IDs: ENSG00000166200
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114290,118700,180849,188570,201400,245590,274300,277440,300200,605115

Library Location

Plate ID: GDExl11085
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ837738
dbEST ID: 79655440
Trimmed Sequence: ATGTCTGACATGGAGGATGACTTGAAGAAGGGTACACAACTACTGGAAATATATGCTTTGGAAATTCAGATGTATACAGCACAGAAGAACAATAAGAAACTCAAAGCATTATATGAACAGTCACTGCACATTAAATCTGCTATCCCTCATCCCCTTATAATGGGAGTCATTCGTGAATGTGGAGGAAAAATGCATTTAAGAGAAGGAGAGTTTGAAAAGGCCCACACAGATTTCTTTGAGGCTTTTAAAAACTATGATGAATCTGGCAGTCCTAGGCGAACAACCTGCTTGAAATACCTTGTCCTAGCAAACATGCTTATGAAGTCTGGAATAAACCCTTTTGACTCTCAGGAGGCTAAACCGTACAAAAATGACCCAGAAATTCTTGCAATGACAAATTTAGTAAGTGCCTATCAGAATAATGACATCACTGAATTTGAAAAGATTCTGAAAACAAATCACAGCAACATCATGGATGATCCCTTTATAAGGGAACATATTGAAGAGCTTTTGCGGAACATCCGAACACAAGTGCTTATAAAGTTAATTAAGCCTTATACAAGAATACATATTCCTTTCATTTCGAAGGAGCTAAATATAGATGTAGCCGATGTTGAGAGTTTGCTGGTGCAGTGTATACTGGATACACCATTAATGGGAAAATTGATCAAGTCCACCCACTCCTCGAACTTAACCATCGAAAAAAAGGTGGGGGCCGAGAGCCTGCCTTAAAATAATGA
Full Trace Sequence: GAGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGACATGGAGGATGACTTGAAGAAGGGTACACAACTACTGGAAATATATGCTTTGGAAATTCAGATGTATACAGCACAGAAGAACAATAAGAAACTCAAAGCATTATATGAACAGTCACTGCACATTAAATCTGCTATCCCTCATCCCCTTATAATGGGAGTCATTCGTGAATGTGGAGGAAAAATGCATTTAAGAGAAGGAGAGTTTGAAAAGGCCCACACAGATTTCTTTGAGGCTTTTAAAAACTATGATGAATCTGGCAGTCCTAGGCGAACAACCTGCTTGAAATACCTTGTCCTAGCAAACATGCTTATGAAGTCTGGAATAAACCCTTTTGACTCTCAGGAGGCTAAACCGTACAAAAATGACCCAGAAATTCTTGCAATGACAAATTTAGTAAGTGCCTATCAGAATAATGACATCACTGAATTTGAAAAGATTCTGAAAACAAATCACAGCAACATCATGGATGATCCCTTTATAAGGGAACATATTGAAGAGCTTTTGCGGAACATCCGAACACAAGTGCTTATAAAGTTAATTAAGCCTTATACAAGAATACATATTCCTTTCATTTCGAAGGAGCTAAATATAGATGTAGCCGATGTTGAGAGTTTGCTGGTGCAGTGTATACTGGATACACCATTAATGGGAAAATTGATCAAGTCCACCCACTCCTCGAACTTAACCATCGAAAAAAAGGTGGGGGCCGAGAGCCTGCCTTAAAATAATGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGACATGGAGGATGACTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837737
dbEST ID: 79655439
Trimmed Sequence: AGCAAGCTTGCTGACTACAGCCTGGTTGAGAGAATTCAGCTGATTGGTCCATTTATCTAACGCAGTGTATCGTGCCCCACCTCTCTTCTGATGGTCAAGTTCGAGGAGCTGGTTGACTTGATCAATTCTCCCATTAATGGTGTTATCCAGTATACACTGCACCAGCAAACTCTCAACATCGGCTACATCTATATTTAGCTCCTTCGAAATGAAAGGAATATGTATTCTTGTATAAGGCTTAATTAACTTTATAAGCACTTGTGTTCGGATGTTCCGCAAAAGCTCTTCAATATGTTCCCTTATAAAGGGATCATCCATGATGTTGCTGTGATTTGTTTTCAAAATCTTTTCAAATTCAGTGATGTCATTATTCTGATAGGCACTTACTAAATTTGTCATTGCAAGAATTTCTGGGTCATTTTTGTACGGTTTAGCCTCCTGAGAGTCAAAAGGGTTTATTCCACACTTCATAAGCATGTTTGCTAGGAGAAGGTATTTCAAACAGGTTGTTCGCCTAGGACTGCCGGATTCATCATAGTTTTTAAAAACCTCAGAGAGATCGGTGTGGGGGGTGTGCAACTCGCCTTCTCTTACATGGATTTTTCCTTCCCCTTCACCAAGGACGCGCGCTATAAGGGGGGGAGGGAGGGGGGAATTAAGGGGGGGGGGGGGGTCATGGGATGCGTTGAGTTTCTTATTTTTTTCTGTTCGGGGGGGGGCGGAGGTTCAGAGGAAGGTGTGCGGTACTTTGGGGAGGATGGTCGGGCAAAAGAGAAGGAGAAGGAGAAAGGGGGGGTGTTATAAAAGGATGGGGGGGTGGAAAAAAGAAAAAATGTGTGGGTGGCACGGGGGGACGCGGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAGCAAAAAAAAGGCGGGGGAAAAATACAAGAAAAANAGGGGCGACNAGGNAACCGGAGCCTGGGGGTGTGGGGAGGGGGGGAGGGGAGAGCCAGAGGAGAAGAGGGCGGGGGCGAGGGGAAGGAGGGAGAGGAGGGGGGGGGGGAGGGGGCCGCAGGGGGGGGGGGGAATGGAANANNAAGGGGGGGNGGNNGGGGGAGAANAGGGCGGGNNGGNNGNGGCGNAANNNNNAAGCNAAGGGGGGNANAGGAGGAGTGGGGGGGGNATGGGGNANNNGGNAAGGGAGAGGGAAAGAGAGAAAAAAAAAAAGA
Full Trace Sequence: GGCCAAGGTAACAGCCATCGAAGCATGGAAAACGAACCACTAGACGGGGAAACCAGCCAGGAGGGCAAAAATGATTATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCAAGCTTGCTGACTACAGCCTGGTTGAGAGAATTCAGCTGATTGGTCCATTTATCTAACGCAGTGTATCGTGCCCCACCTCTCTTCTGATGGTCAAGTTCGAGGAGCTGGTTGACTTGATCAATTCTCCCATTAATGGTGTTATCCAGTATACACTGCACCAGCAAACTCTCAACATCGGCTACATCTATATTTAGCTCCTTCGAAATGAAAGGAATATGTATTCTTGTATAAGGCTTAATTAACTTTATAAGCACTTGTGTTCGGATGTTCCGCAAAAGCTCTTCAATATGTTCCCTTATAAAGGGATCATCCATGATGTTGCTGTGATTTGTTTTCAAAATCTTTTCAAATTCAGTGATGTCATTATTCTGATAGGCACTTACTAAATTTGTCATTGCAAGAATTTCTGGGTCATTTTTGTACGGTTTAGCCTCCTGAGAGTCAAAAGGGTTTATTCCACACTTCATAAGCATGTTTGCTAGGAGAAGGTATTTCAAACAGGTTGTTCGCCTAGGACTGCCGGATTCATCATAGTTTTTAAAAACCTCAGAGAGATCGGTGTGGGGGGTGTGCAACTCGCCTTCTCTTACATGGATTTTTCCTTCCCCTTCACCAAGGACGCGCGCTATAAGGGGGGGAGGGAGGGGGGAATTAAGGGGGGGGGGGGGGTCATGGGATGCGTTGAGTTTCTTATTTTTTTCTGTTCGGGGGGGGGCGGAGGTTCAGAGGAAGGTGTGCGGTACTTTGGGGAGGATGGTCGGGCAAAAGAGAAGGAGAAGGAGAAAGGGGGGGTGTTATAAAAGGATGGGGGGGTGGAAAAAAGAAAAAATGTGTGGGTGGCACGGGGGGACGCGGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAGCAAAAAAAAGGCGGGGGAAAAATACAAGAAAAANAGGGGCGACNAGGNAACCGGAGCCTGGGGGTGTGGGGAGGGGGGGAGGGGAGAGCCAGAGGAGAAGAGGGCGGGGGCGAGGGGAAGGAGGGAGAGGAGGGGGGGGGGGAGGGGGCCGCAGGGGGGGGGGGGAATGGAANANNAAGGGGGGGNGGNNGGGGGAGAANAGGGCGGGNNGGNNGNGGCGNAANNNNNAAGCNAAGGGGGGNANAGGAGGAGTGGGGGGGGNATGGGGNANNNGGNAAGGGAGAGGGAAAGAGAGAAAAAAAAAAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCAAGCTTGCTGACTAC