ORFeome > cops4 ORF1 – XORFeome v1.0

cops4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cops4
Gene ID: 967031
Gene Page ID: 967023
ORF Xenbase ID: 17270439

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC131887
Original XGC clone length: 1221

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ838535
dbEST ID: 79656237
Trimmed Sequence: ATGGCAGCCTCTGTCAGACAAGATCTTACACAATTGATGAATTCTAGCGGATCGCATAAGGATCTTGCCGGAAAGTACCGTCAAATATTAGAGAAAGCACTTCAACTCAATGGCCCAGAACAACTTGAAGCATTGAAAGCTTTTGTTGAAGCCATGGTAAATGAAAATGTCAGTTTGGTGATTTCACGTCAGCTACTCACTGATTTCTGCACCCTCCTCCCCAGTCTGCCTGATGGCATAGCTAAGGAAATCTACCACTTCACCCTGGAGAAGATCCAGCCAAGAGTTATTTCTTTTGAAGAACAGGTTGCATCAATCAGACAGCATTTGGCATCCATTTATGAGAAAGAAGAGGACTGGAGAAATGCTGCTCAAGTGCTAGTGGGGATACCTTTAGAAACAGGACAAAAACATACAACGTAGACAATTAATTAGAGACCTACTTTGAAAATGCCCCGGCTGTTCTTGGAAGATGATGACCCAGTACAGGGCGGAAGCCTACTTTAACAAAACCTCTCTTTTTGCAAATGAGTCAACAAATGAAAAGCTTCCAATCCATTTAAAGGGGGTGCATGGCCGCTGGGCCTGGACTAAAAAAAAAAATTTAAAAAAGGCTGCCCCCCCAATACATGGACTTGTTCTAACAAACCCAATTGGCTTAAAACCTAAAAAAAAGAAGGGGGTTTAAAAAATGGCACAACACCGGGCCTTTAAAAAAAACTTTTTATAGGTTTCAAAAGGGGGTTTTCTTCTTATTTTCGGGGGGTGAGTT
Full Trace Sequence: CCGCGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCCTCTGTCAGACAAGATCTTACACAATTGATGAATTCTAGCGGATCGCATAAGGATCTTGCCGGAAAGTACCGTCAAATATTAGAGAAAGCACTTCAACTCAATGGCCCAGAACAACTTGAAGCATTGAAAGCTTTTGTTGAAGCCATGGTAAATGAAAATGTCAGTTTGGTGATTTCACGTCAGCTACTCACTGATTTCTGCACCCTCCTCCCCAGTCTGCCTGATGGCATAGCTAAGGAAATCTACCACTTCACCCTGGAGAAGATCCAGCCAAGAGTTATTTCTTTTGAAGAACAGGTTGCATCAATCAGACAGCATTTGGCATCCATTTATGAGAAAGAAGAGGACTGGAGAAATGCTGCTCAAGTGCTAGTGGGGATACCTTTAGAAACAGGACAAAAACATACAACGTAGACAATTAATTAGAGACCTACTTTGAAAATGCCCCGGCTGTTCTTGGAAGATGATGACCCAGTACAGGGCGGAAGCCTACTTTAACAAAACCTCTCTTTTTGCAAATGAGTCAACAAATGAAAAGCTTCCAATCCATTTAAAGGGGGTGCATGGCCGCTGGGCCTGGACTAAAAAAAAAAATTTAAAAAAGGCTGCCCCCCCAATACATGGACTTGTTCTAACAAACCCAATTGGCTTAAAACCTAAAAAAAAGAAGGGGGTTTAAAAAATGGCACAACACCGGGCCTTTAAAAAAAACTTTTTATAGGTTTCAAAAGGGGGTTTTCTTCTTATTTTCGGGGGGTGAGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCCTCTGTCAGACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838534
dbEST ID: 79656236
Trimmed Sequence: TTGTGTCATTTGAACCTCCATAGATTGGGCTGTCCAGTCTGGGGCTGTCTGGCTGATCTTTTCCAACAGGTTATTGACTTGAAAACACAATGACTGTATCTGCTTATCCCATGTTGGTAATGCTTCTCGTGTTTCAAAATGAACAATCCCATCAATCTGGTCAATGAATCCATTCATTCGTCCCTCTGTAATCATCTGAGAAGCTATTTTTTCTGCCTTAGCAGCTGGAATTTCTAATAAAGCTCCAAGTTCCTCAAATGTAATATTATTGTAAAGCTTGCTTGCTGATAACAAGTTGTGCTCAATCACAGCTCTGTCCAATATACTCGAACCATCTCCAGTTGTAGCTTTTTGATGCGGCATGAGCATAGCAGCAAACTCCTGAAGCTGATTTCCCCTTATGATCCTATCCAGGTACATCTTCTCCAGGATTCCATAGGCAGCCAGCTGCTGGCATCGCTCATCCTTAAACAAAGTAGCCAGCATACGAGAACGCTGTTGACCTGCAGAAGCTAGTATAGTGCAGTGTAGTGCATGTTTTAACGCCTCCATCCTCTCAGTTTCATGCACCTATGGTTTTGTATGACAGCTCATTGTATCGCTGAGCAGCCTCTATAAATTTTCTCTTGTAATCCAGCACACCGGCATAGCACACCTTATAATGGATTTGAAACTTTTTCATTGGGTTTACTCAATTCTGCAAAAAAAAACGCATCCTTT
Full Trace Sequence: GGGGAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGTGTCATTTGAACCTCCATAGATTGGGCTGTCCAGTCTGGGGCTGTCTGGCTGATCTTTTCCAACAGGTTATTGACTTGAAAACACAATGACTGTATCTGCTTATCCCATGTTGGTAATGCTTCTCGTGTTTCAAAATGAACAATCCCATCAATCTGGTCAATGAATCCATTCATTCGTCCCTCTGTAATCATCTGAGAAGCTATTTTTTCTGCCTTAGCAGCTGGAATTTCTAATAAAGCTCCAAGTTCCTCAAATGTAATATTATTGTAAAGCTTGCTTGCTGATAACAAGTTGTGCTCAATCACAGCTCTGTCCAATATACTCGAACCATCTCCAGTTGTAGCTTTTTGATGCGGCATGAGCATAGCAGCAAACTCCTGAAGCTGATTTCCCCTTATGATCCTATCCAGGTACATCTTCTCCAGGATTCCATAGGCAGCCAGCTGCTGGCATCGCTCATCCTTAAACAAAGTAGCCAGCATACGAGAACGCTGTTGACCTGCAGAAGCTAGTATAGTGCAGTGTAGTGCATGTTTTAACGCCTCCATCCTCTCAGTTTCATGCACCTATGGTTTTGTATGACAGCTCATTGTATCGCTGAGCAGCCTCTATAAATTTTCTCTTGTAATCCAGCACACCGGCATAGCACACCTTATAATGGATTTGAAACTTTTTCATTGGGTTTACTCAATTCTGCAAAAAAAAACGCATCCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGTGTCATTTGAACCTCCATAG