ORFeome > coq6 ORF1 – XORFeome v1.0

coq6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: coq6
Gene ID: 945932
Gene Page ID: 945925
ORF Xenbase ID: 17270493

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097912
Original XGC clone length: 1395

Human orthology & disease relationships

NCBI Entrez ID: 51004
Ensembl gene IDs: ENSG00000119723
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 176270,272200,302950

Library Location

Plate ID: GDExl11089
Well Location: F05

Sequences - 5ʹ (forward) EST

Accession: JZ838363
dbEST ID: 79656065
Trimmed Sequence: ATGCGGTGCTTATGTGGCTCATCCATGTCTAGACTCGTGCGGATGCTGTCTCAGCCTCAAGGCCGAGCTTTGAGTTCCACTGGTCCTGCTGTATATGATGTGATTATATCTGGCGGTGGTATGGTTGGAACGGCAATGGCCTGTGCATTGGGCTCGGATCCTCACTTGCAACACAAGAGAATTCTTTTGCTAGAAGCTGGGCAAAGAAAACCATTTGATCGTCTACCAGAGAGCTTCAGCAACAGAGTGAGCTCCATTACCCCAGGCTCAGCAACCCTACTTGCCAGTTTTGGTGCTTGGGACCATATCTTGGGCATGAGGCTAAAACCATATAAGAGAATGCAGGTTTGGGATGCCTGCTCAGATGCGCTGATCACATTTGACAAGGATGAAATGGAAGATATGGGATATATTGTGGAAAATAATGTTATTATTGCAGCACTTACAAAGCAGCTGGAATTAATGTCTGATCATATTGAGGTTATGTACAGAAGCAGAGCTTTGGGCTACACATGGCCCCCACCATATAATAATGGTGAAGCCACCCCTTGGGTAGAGATAGAGCTAGCAGATGGCCAAAGGCTCCATACAAAACTCTTGATTGGTGCAGATGGCCACAACTCCATGGTGCGTAGTGCAACTGGAATGCAGAGTGTCCAGTGGGATTTACATCATGCTGCTGTAGTTGCTACACTTTTATTGTCTGAAACCACCTAATACAAACATGCCCT
Full Trace Sequence: GGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGGTGCTTATGTGGCTCATCCATGTCTAGACTCGTGCGGATGCTGTCTCAGCCTCAAGGCCGAGCTTTGAGTTCCACTGGTCCTGCTGTATATGATGTGATTATATCTGGCGGTGGTATGGTTGGAACGGCAATGGCCTGTGCATTGGGCTCGGATCCTCACTTGCAACACAAGAGAATTCTTTTGCTAGAAGCTGGGCAAAGAAAACCATTTGATCGTCTACCAGAGAGCTTCAGCAACAGAGTGAGCTCCATTACCCCAGGCTCAGCAACCCTACTTGCCAGTTTTGGTGCTTGGGACCATATCTTGGGCATGAGGCTAAAACCATATAAGAGAATGCAGGTTTGGGATGCCTGCTCAGATGCGCTGATCACATTTGACAAGGATGAAATGGAAGATATGGGATATATTGTGGAAAATAATGTTATTATTGCAGCACTTACAAAGCAGCTGGAATTAATGTCTGATCATATTGAGGTTATGTACAGAAGCAGAGCTTTGGGCTACACATGGCCCCCACCATATAATAATGGTGAAGCCACCCCTTGGGTAGAGATAGAGCTAGCAGATGGCCAAAGGCTCCATACAAAACTCTTGATTGGTGCAGATGGCCACAACTCCATGGTGCGTAGTGCAACTGGAATGCAGAGTGTCCAGTGGGATTTACATCATGCTGCTGTAGTTGCTACACTTTTATTGTCTGAAACCACCTAATACAAACATGCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGGTGCTTATGTGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838362
dbEST ID: 79656064
Trimmed Sequence: TTTGCTTGCAAAGGCCATAATCTGCTCTTTTACTGGAGTCAGTGCATTCGTAGCTTGCAGGCCAAGCGTCCTGAGAAGTACAATTGGGGGCTGTTTTGTGTTGTATAATCTCTTTAGCAGATCAACTGCAGCCATTAAAGGAATATTGTGCCTCTGTCGATCAGTCTCATATTCTAGAAGGTGCTTTGTTGAGCCCAGGTCACTTCCATTGAATGCAGCTTGACTCAGATGATGGGCCAAACAGGCAACATCCCCAAAGCCCATATTTACTCCTTGACCTGCCAGAGGGTGCACTCTGTGTGCTGCGTCACCAATAAGTGCCACTCTATGCCGGATATATTCAGTGGCATGTCTCAATCCCAAAGGATAGGCAATCCTACTGCTCTGCTCAACACGTGACATGCTGGGAGGGAGCTGACGAGGAGAGGAGCCAGATGGCACGAAGAAAGACAAAGCTGAGCGAAGTATAGAGCCAGCTGAAGTTATGAACTCTGAATGATTCTCACTGCTCTCAAATGCCGAATTGACTGTATCTACCAAGCTTTCATCGTCCATACTGACAAGCTCTGATGCATGTTCAGGAGATGTAGACCACACTAGGAACTACCACTATCACAAAGAGGCAGTAATGCGATGGGCCCCAGTGGGAAAGAAACCTCTGCCAGGCAATGGTTGTTATCAATTTGCTTCAAACAAAATAAGTTGGAACCACCTACCGGCCGCCG
Full Trace Sequence: GGGAAAATGCTACTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTATACAAGAAAGTTGGCAATTTGCTTGCAAAGGCCATAATCTGCTCTTTTACTGGAGTCAGTGCATTCGTAGCTTGCAGGCCAAGCGTCCTGAGAAGTACAATTGGGGGCTGTTTTGTGTTGTATAATCTCTTTAGCAGATCAACTGCAGCCATTAAAGGAATATTGTGCCTCTGTCGATCAGTCTCATATTCTAGAAGGTGCTTTGTTGAGCCCAGGTCACTTCCATTGAATGCAGCTTGACTCAGATGATGGGCCAAACAGGCAACATCCCCAAAGCCCATATTTACTCCTTGACCTGCCAGAGGGTGCACTCTGTGTGCTGCGTCACCAATAAGTGCCACTCTATGCCGGATATATTCAGTGGCATGTCTCAATCCCAAAGGATAGGCAATCCTACTGCTCTGCTCAACACGTGACATGCTGGGAGGGAGCTGACGAGGAGAGGAGCCAGATGGCACGAAGAAAGACAAAGCTGAGCGAAGTATAGAGCCAGCTGAAGTTATGAACTCTGAATGATTCTCACTGCTCTCAAATGCCGAATTGACTGTATCTACCAAGCTTTCATCGTCCATACTGACAAGCTCTGATGCATGTTCAGGAGATGTAGACCACACTAGGAACTACCACTATCACAAAGAGGCAGTAATGCGATGGGCCCCAGTGGGAAAGAAACCTCTGCCAGGCAATGGTTGTTATCAATTTGCTTCAAACAAAATAAGTTGGAACCACCTACCGGCCGCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGCTTGCAAAGGCCATAATC