ORFeome > cotl1 ORF1 – XORFeome v1.0

cotl1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cotl1
Gene ID: 6077892
Gene Page ID: 943480
ORF Xenbase ID: 17270541

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046940
Original XGC clone length: 429

Human orthology & disease relationships

NCBI Entrez ID: 23406
Ensembl gene IDs: ENSG00000103187
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 254600,261500,608643

Library Location

Plate ID: GDExl11016
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ824369
dbEST ID: 79642071
Trimmed Sequence: ATGGCAACGAAAATTGACAAGGAAGCGTGCAGAGAAGCTTACAATCTGGTGAGAGATGATACCAATGAAACGAGCTGGGTAACTTTTATATATGATGGCCATACAATAGTCCCAGGAGAACAGGGTGAAACCTATGAAGAATTTGTTTCTACTTGCAAAGATGATATCAGGCTGTATGCTTACATCCGATTCATAACTGGGGATGCCATGAGCAAGAGAACCAAGTTTGTCCTAATCACCTGGATCGGTGAACATGTTGGTGGCCTCCAGAGAGCCAAAACTGGTACAGACAAGACCCTGGTGAAAGATGTAGTGCAGAACTTTGCCAAAGAGTTAGTGATCACAGAGTATAAAGAGCTGGAGGAAGAATACATTAGGAACGAGTTGAAGAAAGCAGGCGGAGCCAATTACGATGCCCAAGCTGAGTT
Full Trace Sequence: CCAGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAACGAAAATTGACAAGGAAGCGTGCAGAGAAGCTTACAATCTGGTGAGAGATGATACCAATGAAACGAGCTGGGTAACTTTTATATATGATGGCCATACAATAGTCCCAGGAGAACAGGGTGAAACCTATGAAGAATTTGTTTCTACTTGCAAAGATGATATCAGGCTGTATGCTTACATCCGATTCATAACTGGGGATGCCATGAGCAAGAGAACCAAGTTTGTCCTAATCACCTGGATCGGTGAACATGTTGGTGGCCTCCAGAGAGCCAAAACTGGTACAGACAAGACCCTGGTGAAAGATGTAGTGCAGAACTTTGCCAAAGAGTTAGTGATCACAGAGTATAAAGAGCTGGAGGAAGAATACATTAGGAACGAGTTGAAGAAAGCAGGCGGAGCCAATTACGATGCCCAAGCTGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCACGTGTCTCAATTTTTTNTATATTTTAAAAAAAGNTGNNTTTCGGTGGGACTTCGCTCTTTTGGGGGTGGGCCCCCGATCTTGCCTACCGGGGGGGAGTTTCTCTTGTTGGAGGCTCGGGTAGAAAAACAAATTTTGTTCGGCCCCCGGGGGGATGCCGCCCCCCTTTACACCGGGCGAGGGACAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACGAAAATTGACAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829728
dbEST ID: 79647430
Trimmed Sequence: CTCAGCTTGGGCATCGTAATTGGCTCCGCCTGCTTTCTTCAACTCGTTCCTAATGTATTCTTCCTCCAGCTCTTTATACTCTGTGATCACTAACTCTTTGGCAAAGTTCTGCACTACATCTTTCACCAGGGTCTTGTCTGTACCAGTTTTGGCTCTCTGGAGGCCACCAACATGTTCACCGATCCAGGTGATTAGGACAAACTTGGTTCTCTTGCTCATGGCATCCCCAGTTATGAATCGGATGTAAGCATACAGCCTGATATCATCTTTGCAAGTAGAAACAAATTCTTCATAGGTTTCACCCTGTTCTCCTGGGACTATTGTATGGCCATCATATATAAAAGTTACCCAGCTCGTTTCATTGGTATCATCTCTCACCAGATTGTAAGCTTCTCTGCACGCTTCCTTGTCAATTTTCGTTGCCATGG
Full Trace Sequence: GTCAGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCAGCTTGGGCATCGTAATTGGCTCCGCCTGCTTTCTTCAACTCGTTCCTAATGTATTCTTCCTCCAGCTCTTTATACTCTGTGATCACTAACTCTTTGGCAAAGTTCTGCACTACATCTTTCACCAGGGTCTTGTCTGTACCAGTTTTGGCTCTCTGGAGGCCACCAACATGTTCACCGATCCAGGTGATTAGGACAAACTTGGTTCTCTTGCTCATGGCATCCCCAGTTATGAATCGGATGTAAGCATACAGCCTGATATCATCTTTGCAAGTAGAAACAAATTCTTCATAGGTTTCACCCTGTTCTCCTGGGACTATTGTATGGCCATCATATATAAAAGTTACCCAGCTCGTTTCATTGGTATCATCTCTCACCAGATTGTAAGCTTCTCTGCACGCTTCCTTGTCAATTTTCGTTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGAACCGAGGTTAGGACTGGCAGTCGGTTTCACGTCNTGGGCCCGGGGAAGGGGGCCTGCCGGTTCTTCGCTGTGTCTCTAATCTCCTTGGCAATGGTAATGAGACCAAAACACGACCCCCAGCCTTGCAAACCCAATCTGGCCTTGAGCGGGTGTTAACTAGGATTGGTCTCGGGGCCTGCCACATAATTAACAAGGNCCAAACTCCCCCCGGTTAGATACCCAACAAAAATATGCTATCCAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAGCTTGGGCATCGT