ORFeome > cox10 ORF1 – XORFeome v1.0

cox10 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cox10
Gene ID: 6252464
Gene Page ID: 954607
ORF Xenbase ID: 17270547

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123368
Original XGC clone length: 1260

Human orthology & disease relationships

NCBI Entrez ID: 1352
Ensembl gene IDs: ENSG00000006695
Directly associated (OMIM) disease MIM numbers: 220110,256000
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ837495
dbEST ID: 79655197
Trimmed Sequence: ATGAGAGGGGTATCAGCTATGTGCCTGGCACAGCTTCATGGCAAAGTCACAGGGCAACTTATCGCCTGTCGGGTTCTGCAGATATGCAGGAGACACCCTGACCGCTGGCCTTTATTTCATCCACCCAGATGTAAGTATGTGACACAGCACATAACCTTAAACCAAAGAGTCAAGCCGAAACCAGAGACAGTAGAAAGCTCTGTCCAAGAGGAGACAATTGTACAAGAAGTAAAAGCCACATCCACAACTTTCCCTTTACCTACCCCCGAATCATACAAAAATGCAACTACTCAGGGACCCCCAGCTGATCACAAGCTACCGCCCTCAGCCAATGAGGAACGGGGCTGGAGGGAAATGAAAGTCGAAATATCTACCCTACCAGGTGTTTTGGCACGGCTCTCAAAAATCAGGCTTACAGCCCTAGTGGTGATAACTGCATCAGCTGGGTATGCCATGGCTCCCGTGTCCTTTGACCCAACTTGTTTCCTGATTGCATCAGTCGGAACCGGTCTGGCTTCCTGTGCTGCCAACTCCATCAACCAGTTCTTCGAGGTGCCATTCGATTCCAACATGAACAGGACAAAGAACCGGCCCCTGGTGCGAGGACAGATAAGCCCACTGATGGCCGTCTCCTTTGCCGCGGCCTGCGCTATCGCCAGGATCTCCTTGCTGACATTTGCCGTTACCCCTCTGACGGGGGCCCCTGGGGGCCTTTAATATCTTCCTGTATACCTGCTGTTACCCGCCCATAAAACGGCTCCACAATGGCAAATAACCTGGGGTGGGGGGTTCTGTGGGTGGGGGGGCCCCCT
Full Trace Sequence: GGGGGCCCAAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGAGGGGTATCAGCTATGTGCCTGGCACAGCTTCATGGCAAAGTCACAGGGCAACTTATCGCCTGTCGGGTTCTGCAGATATGCAGGAGACACCCTGACCGCTGGCCTTTATTTCATCCACCCAGATGTAAGTATGTGACACAGCACATAACCTTAAACCAAAGAGTCAAGCCGAAACCAGAGACAGTAGAAAGCTCTGTCCAAGAGGAGACAATTGTACAAGAAGTAAAAGCCACATCCACAACTTTCCCTTTACCTACCCCCGAATCATACAAAAATGCAACTACTCAGGGACCCCCAGCTGATCACAAGCTACCGCCCTCAGCCAATGAGGAACGGGGCTGGAGGGAAATGAAAGTCGAAATATCTACCCTACCAGGTGTTTTGGCACGGCTCTCAAAAATCAGGCTTACAGCCCTAGTGGTGATAACTGCATCAGCTGGGTATGCCATGGCTCCCGTGTCCTTTGACCCAACTTGTTTCCTGATTGCATCAGTCGGAACCGGTCTGGCTTCCTGTGCTGCCAACTCCATCAACCAGTTCTTCGAGGTGCCATTCGATTCCAACATGAACAGGACAAAGAACCGGCCCCTGGTGCGAGGACAGATAAGCCCACTGATGGCCGTCTCCTTTGCCGCGGCCTGCGCTATCGCCAGGATCTCCTTGCTGACATTTGCCGTTACCCCTCTGACGGGGGCCCCTGGGGGCCTTTAATATCTTCCTGTATACCTGCTGTTACCCGCCCATAAAACGGCTCCACAATGGCAAATAACCTGGGGTGGGGGGTTCTGTGGGTGGGGGGGCCCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGAGGGGTATCAGCTATGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837494
dbEST ID: 79655196
Trimmed Sequence: GCTTGGTTCCAAGATGGCGTCCTTCTCTTTCTTGCCAACCACAGACTTTTTGCAGGTGAACATGAGGAGCAAAAGCATGGGCAGGTGCCACAAGCTACAGAAGAACAGCTTCCTGGAGCTGGAACGGTCCGCGTCCTTGTAGAATCGGTAGCCCAGGTAAGAGATGTAAAAGTTAATGGGAAGCGATATGACTGGAAAGGTCCACGTGGTCACATCTAAAGCAGGAGCTAGGGTGGACAGGCCAATGAGAGCCAGACAATGACGCAACGCCACTTGGCGGCACATGAGTGGATGGGTGACAGACATCATTCTGTAACCCCCTCGGGAATAGTCTTCACGTAGATTCCAACTTAATGCGTTAAAGTGGGGAAACTGCCAGGAGTAGAGAATGCCGCCCAACAGCAAAGCTCCTGCATCCAGGCTCCCAGTAGCTGCTGTCCAGCCCATGACTGGCGGAAGGGCGCCCACCACAGCACCCACCCACGTATTGGCAATGCTGAGCCGTTTCATGGGCGTGTAACAGCANGTATACAGGAAGATATTAAAGGCCCCCACGGCCCCCGTCAGAGGGTTAACGGCAAATGTCAGCAAGGAGATCCCTGCGATAGCGCAGGCCGCGGCAAAGGAGACGGCCATCAATGGGCTTATCTGTCCTCGCACCAAGGGGCCGGGTTCTTTGTTCCTGTTCCTGTTTGGAATCCGAAAGGGCCACCTCCAAAAAAACTGTTTTAAATGGAAATTGGGCAACACAAGAGGAAAACCCAGAA
Full Trace Sequence: GCGAAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTTGGTTCCAAGATGGCGTCCTTCTCTTTCTTGCCAACCACAGACTTTTTGCAGGTGAACATGAGGAGCAAAAGCATGGGCAGGTGCCACAAGCTACAGAAGAACAGCTTCCTGGAGCTGGAACGGTCCGCGTCCTTGTAGAATCGGTAGCCCAGGTAAGAGATGTAAAAGTTAATGGGAAGCGATATGACTGGAAAGGTCCACGTGGTCACATCTAAAGCAGGAGCTAGGGTGGACAGGCCAATGAGAGCCAGACAATGACGCAACGCCACTTGGCGGCACATGAGTGGATGGGTGACAGACATCATTCTGTAACCCCCTCGGGAATAGTCTTCACGTAGATTCCAACTTAATGCGTTAAAGTGGGGAAACTGCCAGGAGTAGAGAATGCCGCCCAACAGCAAAGCTCCTGCATCCAGGCTCCCAGTAGCTGCTGTCCAGCCCATGACTGGCGGAAGGGCGCCCACCACAGCACCCACCCACGTATTGGCAATGCTGAGCCGTTTCATGGGCGTGTAACAGCANGTATACAGGAAGATATTAAAGGCCCCCACGGCCCCCGTCAGAGGGTTAACGGCAAATGTCAGCAAGGAGATCCCTGCGATAGCGCAGGCCGCGGCAAAGGAGACGGCCATCAATGGGCTTATCTGTCCTCGCACCAAGGGGCCGGGTTCTTTGTTCCTGTTCCTGTTTGGAATCCGAAAGGGCCACCTCCAAAAAAACTGTTTTAAATGGAAATTGGGCAACACAAGAGGAAAACCCAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTGGTTCCAAGATGGCGT