ORFeome > cox17 ORF1 – XORFeome v1.0

cox17 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cox17
Gene ID: 958798
Gene Page ID: 958792
ORF Xenbase ID: 17270553

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078552
Original XGC clone length: 198

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ839898
dbEST ID: 79657600
Trimmed Sequence: ATGTCTAGTTTGGCCGCAGCGAGTTGTGAGTCTCAAAGCTCTGAGAGTCAAGAGAAGAAGCCTCTGAAGCCATGCTGTGCGTGTCCAGAGACCAAGAAAGCACGAGATGCCTGCATCATTGAGAAGGGCGAAGAGAACTGTCAGCATCTTATCGAGGCGCACAAGGAGTGTATGAGATCCCTGGGATTCAAAGTGTT
Full Trace Sequence: TCACGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTAGTTTGGCCGCAGCGAGTTGTGAGTCTCAAAGCTCTGAGAGTCAAGAGAAGAAGCCTCTGAAGCCATGCTGTGCGTGTCCAGAGACCAAGAAAGCACGAGATGCCTGCATCATTGAGAAGGGCGAAGAGAACTGTCAGCATCTTATCGAGGCGCACAAGGAGTGTATGAGATCCCTGGGATTCAAAGTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTAAAAAAAAATATGAAATAATAAATCCAGCGATAAGCAATGCAAGGGGTAAAGTAAGCGAAGGGCTCCCTCCTACACCCGGCCCTAGTTGCGTCCGTCTTTTTTGCGGGAAAAGGTCGCGGGGAGGAAAAACACCCTGGAAGGGGGTTTGAGGTGTGGACATAAGGGGGAAAGGGCGGGGCCGGGTCAAAAACTGGAAAACAAAAAGGGGGGGGGGGGCAGGGGGGGGGTTTCGGGATTTTTTGCCGAATTTTTTGGGGGGGTAACGGGCACCCGGGGCCCTCCTCCCGGGGGGGGTAAGGAGGGGGTTTTTTGGGGGGTGGGTGTCCCGCGCCCGGGGCCAAACACGGCGGCCCCCCCCGCTAGCCCCCGGGTGGTGGAGAGGGGTGGGGGGGGGTGGGGGGGCACCCATAAGAGTAGAGGGGGGGGGGGGGGGGGGGGGCGGGGCCACGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTAGTTTGGCCGCAGCGAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839897
dbEST ID: 79657599
Trimmed Sequence: CACTTTGAATCCCAGGGATCTCATACACTCCTTGTGCGCCTCGATAAGATGCTGACAGTTCTCTTCGCCCTTCTCAATGATGCAGGCATCTCGTGCTTTCTTGGTCTCTGGACACGCACAGCATGGCTTCAGAGGCTTCTTCTCTTGACTCTCAGAGCTCTGAGACTCACAACTCGCTGCGGCCAAACTAGACATGG
Full Trace Sequence: GCGAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTTTGAATCCCAGGGATCTCATACACTCCTTGTGCGCCTCGATAAGATGCTGACAGTTCTCTTCGCCCTTCTCAATGATGCAGGCATCTCGTGCTTTCTTGGTCTCTGGACACGCACAGCATGGCTTCAGAGGCTTCTTCTCTTGACTCTCAGAGCTCTGAGACTCACAACTCGCTGCGGCCAAACTAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGTCCGACCTTAATACTGGCCGTCAAATTCACAACAACAAAACATAACTCTTGAGAATGGAATCGCGGCGGTAAAAAAAGCGAAAAGGTCGTTGGGACCCCGGGTCCATAGTGACGCAAGCGGGTAACCGGAAAAAGGGGCCAAGACAAGAAAAAAAAGCAGGAAAGGGTTATAAATTTTAACAAAAAAAGCCAAAAACCCGCCCGGTGGCCAATAACTTTGTGGAACAAACAGGGGGGAAGGGGGGGGGGGGGGGTTAAAGGGTGTGTCAAACTTGTTTTGGGGGGTGCCGTCTAAGTTCGGGGGCCCCAAAGACAAGGCGGGTGACCGGGTTGCTGCGGGTTTGGGTTGTGGTGGGGGTGCGGATGTTAAAAACAAAGGGGGGACCCCCCTCCCACCAAGTGCAAAATAATAGAAGAGAGAGGGAGGGGAGCGGGGGAGAATACCTACAACAACAAAGAAGGGGGAGGGGGGTGTGGGCGCCCCCGACACCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTTGAATCCCAGGGATCTCAT