ORFeome > cox6a1 ORF1 – XORFeome v1.0

cox6a1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cox6a1
Gene ID: 866633
Gene Page ID: 855917
ORF Xenbase ID: 17270601

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078597
Original XGC clone length: 294

Human orthology & disease relationships

NCBI Entrez ID: 1337
Ensembl gene IDs: ENSG00000111775
Directly associated (OMIM) disease MIM numbers: 616039
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ840048
dbEST ID: 79657750
Trimmed Sequence: ATGGCTTCTTTAGGAAGGCTCTCCGGAATTCTTCGCCGTTCATTGCCCATTCGCGGGAGACTTTTTTCCGCAGCTGCAGAGCAAGAGCATGCCGGGGCAGTTCGTACCTGGAAGATCCTGAGCTACGTTGTTGCTTTGCCCGGGGTGGCAGTTTGTATGTTGAATGTCTACTTGAAGATGCAACATCACTCCCATGAGAATCCCGAGTTTATTCCATACGAGCATTTAAGATCCGCACAAAGAGATTTCCATGGGGTGATGGAGACAAGAGTCTGTTCCACAATGCTCATGTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTTTAGGAAGGCTCTCCGGAATTCTTCGCCGTTCATTGCCCATTCGCGGGAGACTTTTTTCCGCAGCTGCAGAGCAAGAGCATGCCGGGGCAGTTCGTACCTGGAAGATCCTGAGCTACGTTGTTGCTTTGCCCGGGGTGGCAGTTTGTATGTTGAATGTCTACTTGAAGATGCAACATCACTCCCATGAGAATCCCGAGTTTATTCCATACGAGCATTTAAGATCCGCACAAAGAGATTTCCATGGGGTGATGGAGACAAGAGTCTGTTCCACAATGCTCATGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGAAAAGTAACAAAATCTCTTATGTTAAAAGAGGGATTGCACGGGCCAGAAAAAAAAAAAGAAAAATAGAAGAAACAGGGCTTTCGGGTTGCCCTTGTTTGGGCAAGGAGAGGAAGGCGGAAAACAACGACACCCAAGCGGGGGGTTTGGAGGGGGGGAAAAAAGCGGGGGAGGGGGCACCACGCGGGCCACACACTTGGGCAAAAAACCCGGGGGGGAGGGCGGGGGGGGGGGGGTTGGGGGTGGGGTGAGGGTTTTTTTGGGACAAAGGGAAACAAAAAAATCAAAAAACAAAAGCCCAGGGGGGGGGGGGGAGGGGGTGTGGGGGGGGGGTTTTTCTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTTTAGGAAGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ840047
dbEST ID: 79657749
Trimmed Sequence: CATGAGCATTGTGGAACAGACTCTTGTCTCCATCACCCCATGGAAATCTCTTTGTGCGGATCTTAAATGCTCGTATGGAATAAACTCGGGATTCTCATGGGAGTGATGTTGCATCTTCAAGTAGACATTCAACATACAAACTGCCACCCCGGGCAAAGCAACAACGTATCTCAGGATCTTCCAGGTACGAACTGCCCCGGCATGCTCTTGCTCTGCAGCTGCGGAAAAAAGTCTCCCGCGAATGGGCAATGAACGGCGAAGAATTCCGGAGAGCCTTCCTAAAGAAGCCATGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGAGCATTGTGGAACAGACTCTTGTCTCCATCACCCCATGGAAATCTCTTTGTGCGGATCTTAAATGCTCGTATGGAATAAACTCGGGATTCTCATGGGAGTGATGTTGCATCTTCAAGTAGACATTCAACATACAAACTGCCACCCCGGGCAAAGCAACAACGTATCTCAGGATCTTCCAGGTACGAACTGCCCCGGCATGCTCTTGCTCTGCAGCTGCGGAAAAAAGTCTCCCGCGAATGGGCAATGAACGGCGAAGAATTCCGGAGAGCCTTCCTAAAGAAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGGCAAACAATTAACAAAATCGTAAATCATCAATATGGGATTGGCCGAGTCGAAAAAAATGAAAGGACATACCTATAAACGCGCTTTCGGTTTAGCGTATTTGGGAAGGGAAACACAGAAGAAAACCCCAAGAAAACAGCGGCGGCTTGTGGATATTTATAATGAGTCCCGGTAGGGACCCCCCCCACCGGTCAAAAACCTTGACCAACGCGGGGGGGGGGTGGGGGGGGGGGGGGGGGTTTCGGTGTGTGTTGAAAAAGTTTTTTTTTTGTATAAAAATATATAGCCAGGCACACGCGCCCCGCGGCGCGGCCCGCGCCCCCGCGGCGTGGTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGAGCATTGTGGAACAGA