ORFeome > cox6a2 ORF1 – XORFeome v1.0

cox6a2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cox6a2
Gene ID: 5784224
Gene Page ID: 5784172
ORF Xenbase ID: 17270613

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128946
Original XGC clone length: 318

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11093
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ838980
dbEST ID: 79656682
Trimmed Sequence: ATGGCGATCCCTGGAGCCCGAATGTCCAGCCTGATCTTCAGGAGAGAGATGGCAAGTGAAGCTCATGGAGAAGGAGCCAGAGCTGCTCGTACCTGGAAGATTCTGTCCTTTGTGGTGGCCCTGCCTGGGGTAGCGGTCTGTATGCTCAATGCTTGGCTGAATAAAGAACACCACCCACAGGAGCGCCCAACGTTTCTGGCTTACGATCATCTGCGCATTCGCACCAAGCGCTTCCCATGGGGTGACGGCAACCACAGTTTCTTCCACAACCCTCACACCAACGCTCTCCCAGCAGGATACGAAGAGCCCAGGCACTT
Full Trace Sequence: GGCCCAAATAATAGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGATCCCTGGAGCCCGAATGTCCAGCCTGATCTTCAGGAGAGAGATGGCAAGTGAAGCTCATGGAGAAGGAGCCAGAGCTGCTCGTACCTGGAAGATTCTGTCCTTTGTGGTGGCCCTGCCTGGGGTAGCGGTCTGTATGCTCAATGCTTGGCTGAATAAAGAACACCACCCACAGGAGCGCCCAACGTTTCTGGCTTACGATCATCTGCGCATTCGCACCAAGCGCTTCCCATGGGGTGACGGCAACCACAGTTTCTTCCACAACCCTCACACCAACGCTCTCCCAGCAGGATACGAAGAGCCCAGGCACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGAAAATAAAACAAGAAGAAAAAAATCTATTCTGGAACACCGGAGAGCCCCGGGACAGAAATGACTCAAAGTCCCTGCTAACAACGGTTGCGTGTGAGTCTCTCTTGGGAAACGGATGAAGGCCCCAACAAAAAGGAACAAAACCGGGTCCGGTTCTTTACTTTAATGGAATACGGGGGGGGCTCACCCCCCCGGGGCCAAACCCTGACGAAAGGCACCGGTGGTACGGGGGAGGGGGCGGTTTTTTGGGGTTTTTTATTTTTGATATTTTTTTTGTTATAAACTTTTTCTCGGCGGGCCCCCCCCCCCCCACGCGCTTTGCCCGCCTGGCCCCACACTGTTTTTTTTTATGTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGATCCCTGGAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ838979
dbEST ID: 79656681
Trimmed Sequence: GTGCCTGGGCTCTTCGTATCCTGCTGGGAGAGCGTTGGTGTGAGGGTTGTGGAAGAAACTGTGGTTGCCGTCACCCCATGGGAAGCGCTTGGTGCGAATGCGCAGATGATCGTAAGCCAGAAACGTTGGGCGCTCCTGTGGGTGGTGTTCTTTATTCAGCCAAGCATTGAGCATACAGACCGCTACCCCAGGCAGGGCCACCACAAAGGACAGAATCTTCCAGGTACGAGCAGCTCTGGCTCCTTCTCCATGAGCTTCACTTGCCATCTCTCTCCTGAAGATCAGGCTGGACATTCGGGCTCCAGGGATCGCCATGG
Full Trace Sequence: GAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGCCTGGGCTCTTCGTATCCTGCTGGGAGAGCGTTGGTGTGAGGGTTGTGGAAGAAACTGTGGTTGCCGTCACCCCATGGGAAGCGCTTGGTGCGAATGCGCAGATGATCGTAAGCCAGAAACGTTGGGCGCTCCTGTGGGTGGTGTTCTTTATTCAGCCAAGCATTGAGCATACAGACCGCTACCCCAGGCAGGGCCACCACAAAGGACAGAATCTTCCAGGTACGAGCAGCTCTGGCTCCTTCTCCATGAGCTTCACTTGCCATCTCTCTCCTGAAGATCAGGCTGGACATTCGGGCTCCAGGGATCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCGACCTTAAAAAAAAAAAATCAAAAACAATTACATGAGGTAGCGGGAACGCCCGGGGACAAAAGGCCAAAAAAAAAAACCAAACAAGGGGCCTTGCTTACTCCGCTTGGTTGACGGGAGAGGGCCGCAAACCAAAGGACAAAACCCGGTGGCGCGCTATAAGAGGAGGGGGAGTACCTGTTCGTCGCGGTGGGAGGGGGCAAAAAAATAACCCACCCCCAGGGAGGAAAACAGCCCCCGGGGGGGTTTTCGGGAGGTTTTTAAATGTTTTTTTTGGGAAAAACTCCCCTCCCGCGGGGCGCGGCGCCCCAACCGCGGTTGTTCCCCCTCGGGGGGGAGGGTGTTGGGGAGGTTGGGGGAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGCCTGGGCTCTTCGT