ORFeome > cox7a2 ORF1 – XORFeome v1.0

cox7a2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cox7a2
Gene ID: 1003873
Gene Page ID: 1003867
ORF Xenbase ID: 17270637

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078611
Original XGC clone length: 252

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ839900
dbEST ID: 79657602
Trimmed Sequence: ATGCTGCGCAATTTACTGGCTCTCCGCCAGATTTCCCAGCGGACCATCAGCAGCTCTACCAGGAGATCTCTGCAAAACAAAGTGCCAGAAAAGCAGAAGATTTTCCAGGAAGATAATGGCATTCCGGTTTACCTGAAGGGGGGTGTTGGTGATGCACTGCTCTATAGACTGACCATGGCTCTTACAGTTTTGGGAACAGGATATGTTCTTTATGAGCTTTTCAATGCCGCTATGCCCAAGAAGAAGAAATT
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGCGCAATTTACTGGCTCTCCGCCAGATTTCCCAGCGGACCATCAGCAGCTCTACCAGGAGATCTCTGCAAAACAAAGTGCCAGAAAAGCAGAAGATTTTCCAGGAAGATAATGGCATTCCGGTTTACCTGAAGGGGGGTGTTGGTGATGCACTGCTCTATAGACTGACCATGGCTCTTACAGTTTTGGGAACAGGATATGTTCTTTATGAGCTTTTCAATGCCGCTATGCCCAAGAAGAAGAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCATATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTAAAAAAAAAAAAAAAGAAACAAAAAAAAAAATTCTCAAAAACCCAAAGAAAAAAAAAAAAAAAACTCCTCGAACCACGGCTTCCGGGGTTGGTTCGGTCTTTGTATTTGAAGAAAACCAAAAACACAAAAAAAAAAAGGAAGGGGTTGTTGTTGGGAAAAAAAAAAAACCGGGGGCCCCCCCGCGCGCAAAAAACCAAAAACAGGAAGGGGGGGGGGGGGGGGGGGGGGGTGTTTGGTTTATAAATATTTTATATATTTTTTCTTGGGTCCCACCCCCCCACGGGCGCCTCCCCCGGGGGTGTGTTTTGGGTTGTTTGTGGGGGGGAAAAATACCACCGGCCGCGCGCCCCCCCCACAAAAATTACGTTGTGGTTTTTGTGGGAGGAGGGGAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCGCAATTTACTGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839899
dbEST ID: 79657601
Trimmed Sequence: TTTCTTCTTCTTGGGCATAGCGGCATTGAAAAGCTCATAAAGAACATATCCTGTTCCCAAAACTGTAAGAGCCATGGTCAGTCTATAGAGCAGTGCATCACCAACACCCCCCTTCAGGTAAACCGGAATGCCATTATCTTCCTGGAAAATCTTCTGCTTTTCTGGCACTTTGTTTTGCAGAGATCTCCTGGTAGAGCTGCTGATGGTCCGCTGGGAAATCTGGCGGAGAGCCAGTAAATTGCGCAGCATGG
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTCTTCTTGGGCATAGCGGCATTGAAAAGCTCATAAAGAACATATCCTGTTCCCAAAACTGTAAGAGCCATGGTCAGTCTATAGAGCAGTGCATCACCAACACCCCCCTTCAGGTAAACCGGAATGCCATTATCTTCCTGGAAAATCTTCTGCTTTTCTGGCACTTTGTTTTGCAGAGATCTCCTGGTAGAGCTGCTGATGGTCCGCTGGGAAATCTGGCGGAGAGCCAGTAAATTGCGCAGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGACTGGCCGTCNAAAAAAAAAAAAAAAGACTAAAAAAATATTAAAGCTCACACCGCCGCGCGCAGAAAAAAAAAAAAAAGGCTCCCCCTAACACCGGGGGCGGGGGGGGGGTTGGTTGGGTGGGGGAGGGAGGAAACCAAAAAAACAACAAAAAAAAGACGGGGGGTGGGTGTTTATTTAGAAAAAAACAAGGGAGGGCCCCGCCCCCCGCCCCCCAAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGGGGGGTTGGTTTTTTTGTTATTTATTAATTATTATATTTGTTGTTTCTTCTCAACCCCCCCCCCACACCCAGCCTCCCCCGGCGGATGGCGCTCGTCGTGTTTGGTGGGTGTAATGTACAAAACCCGCCCGCGCACCCNGGGCCCCCCCGCCGCACCAAGAACAAAAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTCTTCTTGGGCATAGCGG