ORFeome > cox7c ORF1 – XORFeome v1.0

cox7c ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cox7c
Gene ID: 6254324
Gene Page ID: 965100
ORF Xenbase ID: 17270661

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078620
Original XGC clone length: 192

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ839882
dbEST ID: 79657584
Trimmed Sequence: ATGTTCGGTCAGACTGTTCGTAGGTTTGCCACGTCCGCTATTCGCAGGTCCCACTACGAGGAGGGCCCTGGCAAGAACCTGCCTTTCTCCGTTGAAAACAAGTGGCGACTGCTAGGGATGATGACCCTGTTTTTTGGCAGTGGCTTCGCTTTCCCATTCATTATAGTAAGACACCAGCTGTTGAAAAAATT
Full Trace Sequence: CGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCGGTCAGACTGTTCGTAGGTTTGCCACGTCCGCTATTCGCAGGTCCCACTACGAGGAGGGCCCTGGCAAGAACCTGCCTTTCTCCGTTGAAAACAAGTGGCGACTGCTAGGGATGATGACCCTGTTTTTTGGCAGTGGCTTCGCTTTCCCATTCATTATAGTAAGACACCAGCTGTTGAAAAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCNAAAAAATAAAAAAAAAAAAAAAAATAAATGTTCGGATGGCCTGGCCGGGGGAAGAGGAAGGAAAACCCCCAAAACCGACGTGCCGGGGTTGGGGTGTTTCTGTGGGTGGTGGGGGAAAAAACACGGAAAAAAGGAAGAAGGGTGGGAACCGGGTGAAAAATAAGCCGGGTGGGTCCCAACCCGGTAAAAAAAATAACAAAAAGGCCCCGGGGGGGGGGGGGGAGAAGGGTTTGCCCGAATGTTTTTGTGGTTTTTTTGTCTGGGTTTTTTTTCCGGGCCGCCCCACCAAAACCCTCTCCTCGCCGGGCGGGGTCGGTTGTGTTGGGGATAAAACAAAAAAAAACAAACACCCCGCGGGCCCCCCCATCTTTTTATATAAAAGAAAAAAAAGGAGAATTTTTTACACACACCACCCCCCCCCCCACCCACTAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCGGTCAGACTGTTCGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839881
dbEST ID: 79657583
Trimmed Sequence: TTTTTTCAACAGCTGGTGTCTTACTATAATGAATGGGAAAGCGAAGCCACTGCCAAAAAACAGGGTCATCATCCCTAGCAGTCGCCACTTGTTTTCAACGGAGAAAGGCAGGTTCTTGCCAGGGCCCTCCTCGTAGTGGGACCTGCGAATAGCGGACGTGGCAAACCTACNAACAGTCTGACCGAACATGG
Full Trace Sequence: AAAACGTCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTTTCAACAGCTGGTGTCTTACTATAATGAATGGGAAAGCGAAGCCACTGCCAAAAAACAGGGTCATCATCCCTAGCAGTCGCCACTTGTTTTCAACGGAGAAAGGCAGGTTCTTGCCAGGGCCCTCCTCGTAGTGGGACCTGCGAATAGCGGACGTGGCAAACCTACNAACAGTCTGACCGAACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGGCCGTCGTTTTNCAAAAAAAAAAAAAAAAAAAAATAAAATTGACGTGGTCCGTCCGAGCGGGAGAGAGAGAAAAGACTCGCCAAAATCCACCGCTGGGGGTGGGGGGGTTTACGGGGGCGGGGAAGGGAAAAAAAAATAAAAAGGAAGAAAGTCTTTTATTGTTGAATAAAGCGAGGGGGGGGCTTCACCCCTTCGGCAAAATACTCAAAAAACCGCAGGAGGGGTGGGGGGGACGGGGGGTTAATGGTTTTTTTGATAAATTTTTTTTTTTGGTTTTTACCGCCCGGGCAAACCCCCCCCCCACAAGGGCCCCAGCCTGCGCGGGTCGGTGTGGGGGAGGAGAAGAAACAACAAATAGCACACAACAGGGCCCCGGCAGGGGGCGAGACAGAAGGAAAAAAGGAAAAAAAGAGAAGAGAGAGGAAGGACAGCACCTCGCCCCCACCCACCCAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTTCAACAGCTGGTGTCTTAC