ORFeome > cpa1 ORF1 – XORFeome v1.0

cpa1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cpa1
Gene ID: 960036
Gene Page ID: 960031
ORF Xenbase ID: 17270673

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084831
Original XGC clone length: 1263

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ840016
dbEST ID: 79657718
Trimmed Sequence: ATGAAGGGCATACTAGTTTTACTCGCTCTGGTGGCGGCAGCCTCCAGCATGGAGAATTACAGTGGACAACAAGTCCTCCGAATTTTCCCTACTGACGAGGATCAGGTGAACCTGGTGAGGGCGTTGGAAGATCTGGAACATTTACAGATTGATTTTTGGACAAGCCCCACAAAAGTCCTTCTACCCATTGATATCCGAGTTTCATTCCGCAATCTGCAATCAGTGAAAGTCTACCTGGAATCCAACAATATCCAGTACAGCATCATGATTCACGATGTACAGAGCTTGCTAGATGAAGAGCAAAACGAGATGAGACGTAATCGTGCCACCGAGAACGCAAGGTCAACTGACAGCTTCAATTATGCTACCTATCATACATTTGATGAGATCAACGCTTTTATCGATAACTTGGTTAATGAAAATCCAAATTTGGTCAGCAAAATACAGATTGGCTCAAGCTATGAAGGCCGTCCTCTTAATGTTCTGAAGTTCAGCACAGGTCCCAACCGTCCAGCTTTTTGGATTGACACTGGTATCCATTCCCGTGAGTGGGTCACTCAGGCCAGCGGTATCTGGTTTGCCAAGAAAATTGCAACAGATTATGGGAAAGACGCATCCCTGAACAATACACTCAACAATATTGATATCCTCTTGGAAATTGTAACCAACCCTGATGGGCAATGTTTACCCTCATAAATCGGAATCGTAAGGTTGCGGAAAACCCGAACCTCCCAATTCTGGGCTCCCTCTGGGTTGGAAACTGGACCCCACCAAAAACCGGGGAT
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGGCATACTAGTTTTACTCGCTCTGGTGGCGGCAGCCTCCAGCATGGAGAATTACAGTGGACAACAAGTCCTCCGAATTTTCCCTACTGACGAGGATCAGGTGAACCTGGTGAGGGCGTTGGAAGATCTGGAACATTTACAGATTGATTTTTGGACAAGCCCCACAAAAGTCCTTCTACCCATTGATATCCGAGTTTCATTCCGCAATCTGCAATCAGTGAAAGTCTACCTGGAATCCAACAATATCCAGTACAGCATCATGATTCACGATGTACAGAGCTTGCTAGATGAAGAGCAAAACGAGATGAGACGTAATCGTGCCACCGAGAACGCAAGGTCAACTGACAGCTTCAATTATGCTACCTATCATACATTTGATGAGATCAACGCTTTTATCGATAACTTGGTTAATGAAAATCCAAATTTGGTCAGCAAAATACAGATTGGCTCAAGCTATGAAGGCCGTCCTCTTAATGTTCTGAAGTTCAGCACAGGTCCCAACCGTCCAGCTTTTTGGATTGACACTGGTATCCATTCCCGTGAGTGGGTCACTCAGGCCAGCGGTATCTGGTTTGCCAAGAAAATTGCAACAGATTATGGGAAAGACGCATCCCTGAACAATACACTCAACAATATTGATATCCTCTTGGAAATTGTAACCAACCCTGATGGGCAATGTTTACCCTCATAAATCGGAATCGTAAGGTTGCGGAAAACCCGAACCTCCCAATTCTGGGCTCCCTCTGGGTTGGAAACTGGACCCCACCAAAAACCGGGGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGGCATACTAGTTTTACTC

Sequences - 3ʹ (reverse) EST

Accession: JZ840015
dbEST ID: 79657717
Trimmed Sequence: ATAAAGGTTATCACGGGTATGCTCAATCAGCTTGGTGAGTGCAAGCCAGGTCTCCTCTGCGGTTGGAATGATTTGGTTAGCTGGTAGTGCAAATCCATATCGGCCAGTATCTCGCAGCTCAAAACTGTAGGAGTACTTAATTCCCTGATTGTAAGTCCAGTCAATGGTTCCTCCACTTGCTTGATAGATGGTAGCAATGATACTGCCATAGGTGTAAGATGTACCATACAGTGAGGCCAATGCATTAACAGCATTCCTTGACACAGTGTTCAGCTCATTGTGGTCAGGAGTTCGGGCAGTAGTGTATCCATATGGGAAGAGAAGCATCTGGGAGTAGCTGTGAATGGAGACAAATCCTTTGATGTTGCCGTGGCTTTTAACAAAGTCCACAATGGCTTTCACTTCAGGTTCAGAATGGGCAGCACGTCCTCTGTAAGTTACAGTACAGGGATTTGAGCTTGAGCCAGGACCTCCAGACCTGCATCCCAGTTTCTGTTGGGGTCAGTTGCGACACAGAAGGAGCCAGAAGTGGGAAAACTGGATTAAACGCACATACCAATCGAGTTATGAGTGTAAACGAAGCCCATCAGATTTGTTGAGGTTTCCGAAGAGGAATCAGGATTGTTAAGTGGATTTGGTAAGGAATCCATCTTTCCGGTAGGCTGGTCGCAATCTTGCTGGGAAAATTATTATGCGCGTGCCGGTGAGGTGGGGGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAAAGGTTATCACGGGTATGCTCAATCAGCTTGGTGAGTGCAAGCCAGGTCTCCTCTGCGGTTGGAATGATTTGGTTAGCTGGTAGTGCAAATCCATATCGGCCAGTATCTCGCAGCTCAAAACTGTAGGAGTACTTAATTCCCTGATTGTAAGTCCAGTCAATGGTTCCTCCACTTGCTTGATAGATGGTAGCAATGATACTGCCATAGGTGTAAGATGTACCATACAGTGAGGCCAATGCATTAACAGCATTCCTTGACACAGTGTTCAGCTCATTGTGGTCAGGAGTTCGGGCAGTAGTGTATCCATATGGGAAGAGAAGCATCTGGGAGTAGCTGTGAATGGAGACAAATCCTTTGATGTTGCCGTGGCTTTTAACAAAGTCCACAATGGCTTTCACTTCAGGTTCAGAATGGGCAGCACGTCCTCTGTAAGTTACAGTACAGGGATTTGAGCTTGAGCCAGGACCTCCAGACCTGCATCCCAGTTTCTGTTGGGGTCAGTTGCGACACAGAAGGAGCCAGAAGTGGGAAAACTGGATTAAACGCACATACCAATCGAGTTATGAGTGTAAACGAAGCCCATCAGATTTGTTGAGGTTTCCGAAGAGGAATCAGGATTGTTAAGTGGATTTGGTAAGGAATCCATCTTTCCGGTAGGCTGGTCGCAATCTTGCTGGGAAAATTATTATGCGCGTGCCGGTGAGGTGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAAAGGTTATCACGGGTATGCTC