ORFeome > cpe ORF1 – XORFeome v1.0

cpe ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cpe
Gene ID: 952273
Gene Page ID: 952269
ORF Xenbase ID: 17270691

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124928
Original XGC clone length: 1395

Human orthology & disease relationships

NCBI Entrez ID: 1363
Ensembl gene IDs: ENSG00000109472
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 188550,209880,217090,256800

Library Location

Plate ID: GDExl11082
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGGAATAGGCTCTTCCCTGGGTCTCTCACTGGTTGTGCTGCTGCTTCTCGGCTGCTCCACTTCCCTGACCCGGGGTCGCAGGCTGAGCCGGGAGCCCGGGAACATCTCGTTCAAGTATCACCGTTACCCGGAGCTGCCCAACCCGCTGGTGTCTGTGTGGCTGCAGTGTCCTTCCATCATTCGCATCTACACCGGGGAACGGACCTTTGAGGGCCGGAAGCTGCTCGTCATAAAAATCTCCAACAACCCCGGGAAGCACAACCCCGGTGAACCAAAATTTAAATATGTTGGCAATATGCATGGAAACAAACCTGTTGAAAAAAACCTGCTTATATATTTAGCCCATTATTTGTGCAATGAGTACCAAAGGGAAAATGAAACCATTGTCAATCTGATCCATAACACTCGTATCCACATTATGCCTTCTCTGAATCCCAATGGCTTTAAAAAAGCCCCCCACCACCCTGGAAAGATAAAAAACTGGTTTGTAGGACGTATTAACGCTCAAACCATAAACCTGAACAAAAACTTCCCTGATCTTGATCGCATTGTGTACTTAATTGAGCGAGAAGGAGGCACAAACAATCATCTGATGCAAAACCTGAAGAATTCTGTTAATGAAAACACAAACCTTGCTCCCAAAACAAGTACCTGTAATTTCCTGGAATTAGGGAAATCCCCTTTTTTCTTCTCTGCAAACCTTTCATGGAAGAAAATATATTTTCAAAATTATTCCAAATGAAAAAAACACCGCAACCGAAAAGTGGCAAATTAAATACAGTTTCCAATTCCCCCAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGGAATAGGCTCTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837304
dbEST ID: 79655006
Trimmed Sequence: AAAATTCAAGGTCTGTGACATCATCTTCCACCATTCCATCATCTCTTCCTTCTCTTCCTCCTTTCTTTCTGTCAAGGACTCAAGGTCAAAGTCAACCTTAACAGCTGGGCTATAAGGAACAGCTACTTTCTTCACAACAGCCAGATACCCAGGTGCTGAAACTGTAATTTTATAATTTCCAGGTGTCAGCAGTCTCCAGTAGTCACCGTCCTTTGCTGAAGTCACATCATGGTCAATTCCATCAACAGATATAGTAGCATTGGCAATTGGAAAACCATGGTGATCTTTGACAAATCCTGTTATACCACGGTGCACCTGCGTCAAATAGTTCACTAGAGAGTCTTTATTTTCCTCCCAGTAGGACTTCAGCTTTTCTTCTTGAGGAAACTTGTCACAACCAAGCTCAACGGTTATCTCAAAACAATTGCTGCTTAAGTAATTAAAATCTTGCATACCTCCAGGCACACTATACCAAGCTGCACCATTTGTTGTCCCGTCAATGAAACTGGTGTCATCGTCAGATTTGCGGCATGGCTTCCTATCTGGGTCTGACATGGTAGGGTTAAGGGATGAGTAGGCACCAGCTAAACTTTTGAAAATACTGTCATCCTGGCATGCGCTGTAATTATGTGCACCTTCCCCTCCCTGTCCTTGCAAAATGGAAAAATTTGACAATAAA
Full Trace Sequence: GGGAATATGCTAATGACCATGTAATACGACTCACTATANGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAATTCAAGGTCTGTGACATCATCTTCCACCATTCCATCATCTCTTCCTTCTCTTCCTCCTTTCTTTCTGTCAAGGACTCAAGGTCAAAGTCAACCTTAACAGCTGGGCTATAAGGAACAGCTACTTTCTTCACAACAGCCAGATACCCAGGTGCTGAAACTGTAATTTTATAATTTCCAGGTGTCAGCAGTCTCCAGTAGTCACCGTCCTTTGCTGAAGTCACATCATGGTCAATTCCATCAACAGATATAGTAGCATTGGCAATTGGAAAACCATGGTGATCTTTGACAAATCCTGTTATACCACGGTGCACCTGCGTCAAATAGTTCACTAGAGAGTCTTTATTTTCCTCCCAGTAGGACTTCAGCTTTTCTTCTTGAGGAAACTTGTCACAACCAAGCTCAACGGTTATCTCAAAACAATTGCTGCTTAAGTAATTAAAATCTTGCATACCTCCAGGCACACTATACCAAGCTGCACCATTTGTTGTCCCGTCAATGAAACTGGTGTCATCGTCAGATTTGCGGCATGGCTTCCTATCTGGGTCTGACATGGTAGGGTTAAGGGATGAGTAGGCACCAGCTAAACTTTTGAAAATACTGTCATCCTGGCATGCGCTGTAATTATGTGCACCTTCCCCTCCCTGTCCTTGCAAAATGGAAAAATTTGACAATAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAATTCAAGGTCTGTGACATCAT