ORFeome > cplx2 ORF1 – XORFeome v1.0

cplx2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cplx2
Gene ID: 1188204
Gene Page ID: 945622
ORF Xenbase ID: 17270703

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059299
Original XGC clone length: 405

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ824544
dbEST ID: 79642246
Trimmed Sequence: ATGGATTTTGTAATGAAACAGGCCTTAGGGGGGGCCACAAAGGACATGGGGAAGATGCTGGGAGGAGAAGAGGAAAAGGATCCTGATGCTCAGAAAAAGGAAGAGGAGAGGCAAGAAGCTCTTCGGCAGCAAGAGGAAGAACGGAAGGCTAAGTATGCCAAAATGGAAGCAGAGAGAGAAAAAATCCGACAACAAATAAGAGACAAGTATGGTCTGAAGAAGAAGGAAGAGAAAGAAGCAGAAGAGAAAGCAGCCCTGGAACAGCCCTGTGAGGGCAGTTTGACACGTCCTAAGAAAGCTATTCCTGCTGGATGTGGAGATGATGATGAGGAAGAAGAAGAAAGTATTTTGGACACTGTACTCAAGTACCTCCCAGGACCACTTCAGGACATGTTCAAAAAGTT
Full Trace Sequence: CCAATAATGATTTCATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATTTTGTAATGAAACAGGCCTTAGGGGGGGCCACAAAGGACATGGGGAAGATGCTGGGAGGAGAAGAGGAAAAGGATCCTGATGCTCAGAAAAAGGAAGAGGAGAGGCAAGAAGCTCTTCGGCAGCAAGAGGAAGAACGGAAGGCTAAGTATGCCAAAATGGAAGCAGAGAGAGAAAAAATCCGACAACAAATAAGAGACAAGTATGGTCTGAAGAAGAAGGAAGAGAAAGAAGCAGAAGAGAAAGCAGCCCTGGAACAGCCCTGTGAGGGCAGTTTGACACGTCCTAAGAAAGCTATTCCTGCTGGATGTGGAGATGATGATGAGGAAGAAGAAGAAAGTATTTTGGACACTGTACTCAAGTACCTCCCAGGACCACTTCAGGACATGTTCAAAAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAACTTAAGNTGATAATCAAAAACTTCTCCCCCNGTTCGCGGAGACCTGGGCTTCTGGGCCTTATCGGTGGGTCATCTTGCGCCCAGCTTTTCTCTTCGAAAAAGCAAACAAGGGTTAAAGTTCACGGGTAAAACTTTAACTTGAACGCCAAACTTGCCCCTGGTCCAGGGGGAAATTCCCAATTCCGGCCGCCCCGGGGCGGGTGTCAAATGAATAATCCCCTTCTGGTTATATTTTCACAAAACAAAGAGCGAAAAAAACTGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATTTTGTAATGAAACAGGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829896
dbEST ID: 79647598
Trimmed Sequence: CTTTTTGAACATGTCCTGAAGTGGTCCTGGGAGGTACTTGAGTACAGTGTCCAAAATACTTTCTTCTTCTTCCTCATCATCATCTCCACATCCAGCAGGAATAGCTTTCTTAGGACGTGTCAAACTGCCCTCACAGGGCTGTTCCAGGGCTGCTTTCTCTTCTGCTTCTTTCTCTTCCTTCTTCTTCAGACCATACTTGTCTCTTATTTGTTGTCGGATTTTTTCTCTCTCTGCTTCCATTTTGGCATACTTAGCCTTCCGTTCTTCCTCTTGCTGCCGAAGAGCTTCTTGCCTCTCCTCTTCCTTTTTCTGAGCATCAAGATCCTTTTCCTCTTCTCCTCCCAGCATCTTCCCCATGTCCATTGTGGCCCCCCCTATGGCCTGTTTCATTACAAAATCCATGG
Full Trace Sequence: GAACGGGAAACAGCTATGAACATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTTTGAACATGTCCTGAAGTGGTCCTGGGAGGTACTTGAGTACAGTGTCCAAAATACTTTCTTCTTCTTCCTCATCATCATCTCCACATCCAGCAGGAATAGCTTTCTTAGGACGTGTCAAACTGCCCTCACAGGGCTGTTCCAGGGCTGCTTTCTCTTCTGCTTCTTTCTCTTCCTTCTTCTTCAGACCATACTTGTCTCTTATTTGTTGTCGGATTTTTTCTCTCTCTGCTTCCATTTTGGCATACTTAGCCTTCCGTTCTTCCTCTTGCTGCCGAAGAGCTTCTTGCCTCTCCTCTTCCTTTTTCTGAGCATCAAGATCCTTTTCCTCTTCTCCTCCCAGCATCTTCCCCATGTCCATTGTGGCCCCCCCTATGGCCTGTTTCATTACAAAATCCATGGTGCCAACTTTATTGTACAGAGTTGGCATTATAAAATAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGTAAAACGAGATAAAGACTAACCATCGTTTTACACTTCCGTGGCCTGGGAATCNCATCTTGAGCCGGCTGGAGGATGGTCATCCTGGATTTCCGTATGGCAATGAAACGACGGTGAGCTAATAGAAAAGGGAAAAGTGGTTCCCCCTTGCTAACCCGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTTTGAACATGTCCTGAAGTG