ORFeome > cpo ORF1 – XORFeome v1.0

cpo ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cpo
Gene ID: 989450
Gene Page ID: 989446
ORF Xenbase ID: 17270721

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC078533
Original XGC clone length: 1071

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ839743
dbEST ID: 79657445
Trimmed Sequence: ATGATAAAAGATGTACAAGAAATTATAGACAACAGCAATGTGGGTGACTACAGAAGACAGAAAACAATATTGGCTGAATTTGATTATACAAAATACCACCCAATGGATGAGATTTATCAATGGATGGATCAAGTTAAGGAGACATACAGTGACCTGGTTTCTATGCATTACCTAGGATCAACATATGAGCATAGGCCTATTTACTATTTCAAAATTGGCTGGCCTTCTGACAAACCGAAGAAAATTATTTGGATGGACTGCGGGATACATGCTCGTGAATGGATTGCTATTGCGTACTGCCAATGGTTTGTTAAGGAGATTCTTGAAACTCACAAGAACAATCCTTTGCTCCAAAAAGTACTTCATAATATAGACTTCTATGTTGTACCTGTCCTAAATATTGATGGATTTATTTACTCCTGGAATGTGGATCGTCTTTGGAGAAAATCACGGTCTTCTCATAACAATGGAACCTGCTACGGAGTCGACCTCAACCGAAATTTTGATTCACAATGGTGCACTATTGGTGCATCTCACAACTGTAAAGACNATAACATTTTGTGGAACTGGACCTGCATCAGAACCAGAAGCTAATGCTGTGTCTAAAGCTGCTGGGGAGTCTTAAATCTGGAATGTTTTGTGTTTTCTTACAATTCATTCCTACGGTCAACTTATCCTTCTGCCCTATGGNNTATACACGGGAGCCTCTGTTATTCCCGAAGAGATGTTAAATATATCTCAAAAGGCTGCTGCAAAACTCAAGAGAAGCAATGGACCTTAAATTAC
Full Trace Sequence: GGGGGCCCAGATAATAGATTTTATCTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATAAAAGATGTACAAGAAATTATAGACAACAGCAATGTGGGTGACTACAGAAGACAGAAAACAATATTGGCTGAATTTGATTATACAAAATACCACCCAATGGATGAGATTTATCAATGGATGGATCAAGTTAAGGAGACATACAGTGACCTGGTTTCTATGCATTACCTAGGATCAACATATGAGCATAGGCCTATTTACTATTTCAAAATTGGCTGGCCTTCTGACAAACCGAAGAAAATTATTTGGATGGACTGCGGGATACATGCTCGTGAATGGATTGCTATTGCGTACTGCCAATGGTTTGTTAAGGAGATTCTTGAAACTCACAAGAACAATCCTTTGCTCCAAAAAGTACTTCATAATATAGACTTCTATGTTGTACCTGTCCTAAATATTGATGGATTTATTTACTCCTGGAATGTGGATCGTCTTTGGAGAAAATCACGGTCTTCTCATAACAATGGAACCTGCTACGGAGTCGACCTCAACCGAAATTTTGATTCACAATGGTGCACTATTGGTGCATCTCACAACTGTAAAGACNATAACATTTTGTGGAACTGGACCTGCATCAGAACCAGAAGCTAATGCTGTGTCTAAAGCTGCTGGGGAGTCTTAAATCTGGAATGTTTTGTGTTTTCTTACAATTCATTCCTACGGTCAACTTATCCTTCTGCCCTATGGNNTATACACGGGAGCCTCTGTTATTCCCGAAGAGATGTTAAATATATCTCAAAAGGCTGCTGCAAAACTCAAGAGAAGCAATGGACCTTAAATTAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATAAAAGATGTACAAGAAATT

Sequences - 3ʹ (reverse) EST

Accession: JZ839742
dbEST ID: 79657444
Trimmed Sequence: AAACATTGTATAATAGAGACCAATGATAAGAGATAGACTCATAAGATTGGAAGAGAAAATGCTTATAGCACTATTAAAGAACTTTGCATCAACATGTTCAACAATGGTCATTACTCCCGCCATGGTTTCTTCACAAGTAGGTCTGATCTGATTTTCAGGGAGTACAAAGCCATATGTACCAGTGTCTCTCAGCTCAAATGTAAATGAAAAAGGGATTCCTAGATCTTTGGCCCAGTCCCGAGATGACCCAGAATTGGAATATAGTATTTGTGATGTAGATCCAACTCTGTACTCAGTGCCATGCTTCTCTTTGAGTTTTGCAGCAGCCTTTTGAGATATATTTAACATCTCTTCGTGATTAACAGAAGGCTCCGTTGTATAACCATAGGGCAGAAGGATAAGTTGACCGTAGGAATGAATTGTTAAGAAACACAAAACATCAGATTTAAGACTCCCCAGCAGCTTAGACACAGCATTAGCTTCTGGTTCTGATGCAGGTCCAGTTCCACAAAATGTTATGTCTTTACAGTTGTGAGATGCACCAATAGTGCACCATTGTGAATCAAAATTTCGGTTGAGGTCGACTCCGTAGCAGGTTCCATTGTTATGAGAAGACCGTGATTTTCTCCCAAGACCATCCACATTTCCCGGAGTAAATAAATCCCCTCATATTTAAGGACAGGTTACAGCTTAAAATTCCTATATTAGTAAAAT
Full Trace Sequence: GGGAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAACATTGTATAATAGAGACCAATGATAAGAGATAGACTCATAAGATTGGAAGAGAAAATGCTTATAGCACTATTAAAGAACTTTGCATCAACATGTTCAACAATGGTCATTACTCCCGCCATGGTTTCTTCACAAGTAGGTCTGATCTGATTTTCAGGGAGTACAAAGCCATATGTACCAGTGTCTCTCAGCTCAAATGTAAATGAAAAAGGGATTCCTAGATCTTTGGCCCAGTCCCGAGATGACCCAGAATTGGAATATAGTATTTGTGATGTAGATCCAACTCTGTACTCAGTGCCATGCTTCTCTTTGAGTTTTGCAGCAGCCTTTTGAGATATATTTAACATCTCTTCGTGATTAACAGAAGGCTCCGTTGTATAACCATAGGGCAGAAGGATAAGTTGACCGTAGGAATGAATTGTTAAGAAACACAAAACATCAGATTTAAGACTCCCCAGCAGCTTAGACACAGCATTAGCTTCTGGTTCTGATGCAGGTCCAGTTCCACAAAATGTTATGTCTTTACAGTTGTGAGATGCACCAATAGTGCACCATTGTGAATCAAAATTTCGGTTGAGGTCGACTCCGTAGCAGGTTCCATTGTTATGAGAAGACCGTGATTTTCTCCCAAGACCATCCACATTTCCCGGAGTAAATAAATCCCCTCATATTTAAGGACAGGTTACAGCTTAAAATTCCTATATTAGTAAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAACATTGTATAATAGAGACC