ORFeome > cpt2 ORF1 – XORFeome v1.0

cpt2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cpt2
Gene ID: 963406
Gene Page ID: 963399
ORF Xenbase ID: 17270745

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045036
Original XGC clone length: 1980

Human orthology & disease relationships

NCBI Entrez ID: 1376
Ensembl gene IDs: ENSG00000157184
Directly associated (OMIM) disease MIM numbers: 255110,600649,608836,614212
Indirectly associated (Lage, et al.) disease MIM numbers: 201450,201460,255110,255120,264470,300194,300387,600649,604387,606054,608836,609015

Library Location

Plate ID: GDExl11014
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ824186
dbEST ID: 79641888
Trimmed Sequence: ATGGCTCGCTTGCTAACGTCTTCATCTGCCTTGAGATGGAGGACAATAACTTCATCTCAGCCAGTTCTGCTAAGAGCATACAGCTCAGGGAGCTCCGATACAGAGTATCTGCAAAGGAGCATTGTTCCAACTATGCACTTCCAGAAAAGCCTACCAAGGCTGCCAATTCCTAAATTTGAAGACACTATTAAGAGATACCTGAATGCACAAAGACCTCTTCTGGATGATGTTCAATTTAAGAAAACTGAGCAGCTTGCCTTGAACTTTCAGAACGGAGTTGGGAAGCAGCTGCATGAAGAACTAGTGCAGCAGGACAAACAGAACAAACACACAAGCTATATCTCTGGTCCTTGGTTTGATATGTATCTGTGTGCCCGGGATTCCATCGTGCTGAATAGTAATCCCTTCATGTCTTTTACACCTGACCCAAGGCCAGAATATAACAGTCAGCTGATCAGAGCCACAAATATGACCGTTTCTGCCATGCGTTTTTTAAAGACCATGAGAGCTGGGTATTTGGAACCTGAAATCTTTCACTTAAACCCAGCCAAAAGTGACACATTGACATTTCGAAGATTAATTCGGTTTGTGCCCTCCTCTCTTTCCTGGTATGGTGCATATTATGGTGAATGCCTATCCNTTAGACATGTCACAGTATTTTCGCCTTTTTTACTGTACTCGCATTCAAAAACCTTACAGAGATGAACTATTGACGAAAGAAAAAGGTAGAACCCTATCTTGTTCTCCAAAAGGGGAATTTCTTTGTTTTTTGAAGTCCTAAACAAAATGGGAAAAAAAAAAAAGGGGTTTGAAATCCCAGGCCCCTTTCCAACAATCCTGGTTGGAAAAC
Full Trace Sequence: AATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCGCTTGCTAACGTCTTCATCTGCCTTGAGATGGAGGACAATAACTTCATCTCAGCCAGTTCTGCTAAGAGCATACAGCTCAGGGAGCTCCGATACAGAGTATCTGCAAAGGAGCATTGTTCCAACTATGCACTTCCAGAAAAGCCTACCAAGGCTGCCAATTCCTAAATTTGAAGACACTATTAAGAGATACCTGAATGCACAAAGACCTCTTCTGGATGATGTTCAATTTAAGAAAACTGAGCAGCTTGCCTTGAACTTTCAGAACGGAGTTGGGAAGCAGCTGCATGAAGAACTAGTGCAGCAGGACAAACAGAACAAACACACAAGCTATATCTCTGGTCCTTGGTTTGATATGTATCTGTGTGCCCGGGATTCCATCGTGCTGAATAGTAATCCCTTCATGTCTTTTACACCTGACCCAAGGCCAGAATATAACAGTCAGCTGATCAGAGCCACAAATATGACCGTTTCTGCCATGCGTTTTTTAAAGACCATGAGAGCTGGGTATTTGGAACCTGAAATCTTTCACTTAAACCCAGCCAAAAGTGACACATTGACATTTCGAAGATTAATTCGGTTTGTGCCCTCCTCTCTTTCCTGGTATGGTGCATATTATGGTGAATGCCTATCCNTTAGACATGTCACAGTATTTTCGCCTTTTTTACTGTACTCGCATTCAAAAACCTTACAGAGATGAACTATTGACGAAAGAAAAAGGTAGAACCCTATCTTGTTCTCCAAAAGGGGAATTTCTTTGTTTTTTGAAGTCCTAAACAAAATGGGAAAAAAAAAAAAGGGGTTTGAAATCCCAGGCCCCTTTCCAACAATCCTGGTTGGAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCGCTTGCTAACGTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829491
dbEST ID: 79647193
Trimmed Sequence: TTTTAAGGGTTTGTCTTGCAGAACACTGAAGATGTCATCCAGGGATTGATGCACACACTGCACAAACTGTCTCACATCACGTGCCGGGTATGAAGAAACATTGCAGCCAATCCAGTCATCATGTACACCATAGCCTACTCCAAACCCATCGGGCACTACTGGTGCAAAGCCCCCAAGCTGTACAGCAGGGCTGGTGAGTGTGCTGGTGGAAAGAACGTTATGATTTATCTGTGCATATGGGATGTCCTGGTAAATTTCAGGAATCGGAAGCCCCTTGCTAGATGCCAGGTGTCGCAGTGCAAATAAATGCCGATCAAATCCCTGACCCATTGCTGCTTCTTTGGTCAGTTGTCCATGATATTTTGAGCATTCGTGCAGCATGCTGCGGAGCTCTGCTGGGCTATGCTTAGATGGATTCATAACTAATGCCTCTGAACACTTTTTAGTGTATATGGAAGCTGGCCTAATGGTCTCTGTGCGGCCATGCTTAAATGCTGCAGTGCTGCANGATTCATATGTGGCTGTTGTCTTGCCATACTGTCTGAGAAAAGCCATCTGAAAGGAGAGCTGTGAAATAGCATCAGGACTTAACTTCTGTGTCTTTGAGAACTCTTTTCCCTCTTTTTTTGAACTCCATTGTTGCCAATGGAAAGTGCATTTTACAGAAGTGTCAAAACTTATTTTTTGGGCATCTGGTTTTTGCCACCTTTTCAAAAAAATTCATCCTAAATTTAAAAGTGGCAATTCCCTTTTAAAACTGCCT
Full Trace Sequence: TGACGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTAAGGGTTTGTCTTGCAGAACACTGAAGATGTCATCCAGGGATTGATGCACACACTGCACAAACTGTCTCACATCACGTGCCGGGTATGAAGAAACATTGCAGCCAATCCAGTCATCATGTACACCATAGCCTACTCCAAACCCATCGGGCACTACTGGTGCAAAGCCCCCAAGCTGTACAGCAGGGCTGGTGAGTGTGCTGGTGGAAAGAACGTTATGATTTATCTGTGCATATGGGATGTCCTGGTAAATTTCAGGAATCGGAAGCCCCTTGCTAGATGCCAGGTGTCGCAGTGCAAATAAATGCCGATCAAATCCCTGACCCATTGCTGCTTCTTTGGTCAGTTGTCCATGATATTTTGAGCATTCGTGCAGCATGCTGCGGAGCTCTGCTGGGCTATGCTTAGATGGATTCATAACTAATGCCTCTGAACACTTTTTAGTGTATATGGAAGCTGGCCTAATGGTCTCTGTGCGGCCATGCTTAAATGCTGCAGTGCTGCANGATTCATATGTGGCTGTTGTCTTGCCATACTGTCTGAGAAAAGCCATCTGAAAGGAGAGCTGTGAAATAGCATCAGGACTTAACTTCTGTGTCTTTGAGAACTCTTTTCCCTCTTTTTTTGAACTCCATTGTTGCCAATGGAAAGTGCATTTTACAGAAGTGTCAAAACTTATTTTTTGGGCATCTGGTTTTTGCCACCTTTTCAAAAAAATTCATCCTAAATTTAAAAGTGGCAATTCCCTTTTAAAACTGCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTAAGGGTTTGTCTTGCAGAAC