ORFeome > creb3l2 ORF1 – XORFeome v1.0

creb3l2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: creb3l2
Gene ID: 996214
Gene Page ID: 996210
ORF Xenbase ID: 17270787

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129061
Original XGC clone length: 1578

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ838491
dbEST ID: 79656193
Trimmed Sequence: ATGGAAATAATGGAGAGTGGGGATCCGGTGATACAGTGGGACCGCAAGCTGAGCGAGTTGTCTGAGGCTGCCGAGAGCGACTCCTTGTACAACAACACGCCCTTCTCGGAGCTCCTCGATGACTCCGCCCTGTTGGATGTTCTGGGGCAGCTGATGGGGGACCCGTTCCTCACAGAGAAGTACGAGATGATGGAAGTAGAGATGAATCCGAGCTCCCCGTCTCCCATGATCAAAGCGGAACACAGCTACTCCCTGTGCGGAGACTCCCGCCCCCAGTCACCCTTTACTCACGCCTCCTCTGATGACAACTTCAGCGACACCGATCTGACGGGCGATGATTGGTGCCTGAATGGAGAACTCACTGCCACTACCCCTACTACTAAAATCAAGGTGGAAATCCCTCTCGAAGAGACCCCTGGCCTGACCCCATCCGTTACCCTGGCAACCAGTGCAGTCTCCGCTTCCCCAGAGGTGGGCGTCTCGTCTCAGTTGCCAGTTCCGGAGCAGGTCAAGCTTCTGATCCCCGTTGCCCTGCCGCAGATAAAACTGGAGCCGCACGAGGTGGACCAATTCCTTAATCTGTGCCCCAAAGAAATTTGCCCAACAGAAACTCCTCCAATGCCTCCCACCCTCCCCACCACCCTGGCAGTGATTCCAAAGGAGTTAGAGTTCCACCAGGTCTCTTCCCCCTTCCGCCCCATCCAGTCCCCATCCCGTGGCGAATGGGTTGCCCGGGGCCCCCTCCTCCCTTTTCAACTCCCCTTCTACCCCCCGGCGCCCTCCAGAGCCCGCCGGGGAAACGGCGCCTCCCTTCG
Full Trace Sequence: CCGGGGCACACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAATAATGGAGAGTGGGGATCCGGTGATACAGTGGGACCGCAAGCTGAGCGAGTTGTCTGAGGCTGCCGAGAGCGACTCCTTGTACAACAACACGCCCTTCTCGGAGCTCCTCGATGACTCCGCCCTGTTGGATGTTCTGGGGCAGCTGATGGGGGACCCGTTCCTCACAGAGAAGTACGAGATGATGGAAGTAGAGATGAATCCGAGCTCCCCGTCTCCCATGATCAAAGCGGAACACAGCTACTCCCTGTGCGGAGACTCCCGCCCCCAGTCACCCTTTACTCACGCCTCCTCTGATGACAACTTCAGCGACACCGATCTGACGGGCGATGATTGGTGCCTGAATGGAGAACTCACTGCCACTACCCCTACTACTAAAATCAAGGTGGAAATCCCTCTCGAAGAGACCCCTGGCCTGACCCCATCCGTTACCCTGGCAACCAGTGCAGTCTCCGCTTCCCCAGAGGTGGGCGTCTCGTCTCAGTTGCCAGTTCCGGAGCAGGTCAAGCTTCTGATCCCCGTTGCCCTGCCGCAGATAAAACTGGAGCCGCACGAGGTGGACCAATTCCTTAATCTGTGCCCCAAAGAAATTTGCCCAACAGAAACTCCTCCAATGCCTCCCACCCTCCCCACCACCCTGGCAGTGATTCCAAAGGAGTTAGAGTTCCACCAGGTCTCTTCCCCCTTCCGCCCCATCCAGTCCCCATCCCGTGGCGAATGGGTTGCCCGGGGCCCCCTCCTCCCTTTTCAACTCCCCTTCTACCCCCCGGCGCCCTCCAGAGCCCGCCGGGGAAACGGCGCCTCCCTTCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAATAATGGAGAGTGGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838490
dbEST ID: 79656192
Trimmed Sequence: AGAAGTCGTGTTGACCGTCCGGTCCAACTCTATGACTTTGGTGGTGTCGTTATGTCCAAATTCCGAAGTGAACCTGTGCCGCACTGGCATGTCACTGCTGCTGTCGTTTGATAGGCTGAACGGTTTCTCCTGGGACAAATGAAGTTCTTCCAGTAGCGCCGCCTGCTGTTTAGAGATGGTATCAGCTTGAACCTCCCAGGTGTCCTGCGTCTCTAACATCACCGCAGAGCTGTGCAGTTCCTCTACAGCCTGGTGCTCCTCGAAGATAAGGAGTTTGCGGGAACGAACAATAGAAGCAGCGTAGGACTCCGGTGCTGAATACTGGCTCGGCTCATGGATAGTCTTGCTTGATGATGAATACATATCTAAGTTTTGGGTGAAGCTTCCAAAAATAACGGCAAAACACAAGACCACCATCATGAGGCAGGTGCCAGTTTGGGTGCCGGCAGCTTTGCAGGAACGGGTGACTTTGCCTGTGACCATGGCCTGCAGACGCTGGAGTTGCTGAAGTAAAGTCCTGTTGGTTGACTCCAGAACTTCCACCTTCTTGCGCAGCTCGCTGTTCTCAGAGGAACTATTCTCAACCCTCTTCTCCAGGCTGGTCATATATTCTTTCTTTTTCCTGCCACTCTCTTGGGCAGAAATCCTGTTTTTAATCTTTCTGCCGATCTTCTTCAGCGCCCTCCTCTCTGCCTTTGTGAGGGCATTTTTGGGGGGGGGGATGGGGGTGAACCCGGGGGCGACCACGAATTCCCCCTTCCCCTCCCCCCC
Full Trace Sequence: AAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAAGTCGTGTTGACCGTCCGGTCCAACTCTATGACTTTGGTGGTGTCGTTATGTCCAAATTCCGAAGTGAACCTGTGCCGCACTGGCATGTCACTGCTGCTGTCGTTTGATAGGCTGAACGGTTTCTCCTGGGACAAATGAAGTTCTTCCAGTAGCGCCGCCTGCTGTTTAGAGATGGTATCAGCTTGAACCTCCCAGGTGTCCTGCGTCTCTAACATCACCGCAGAGCTGTGCAGTTCCTCTACAGCCTGGTGCTCCTCGAAGATAAGGAGTTTGCGGGAACGAACAATAGAAGCAGCGTAGGACTCCGGTGCTGAATACTGGCTCGGCTCATGGATAGTCTTGCTTGATGATGAATACATATCTAAGTTTTGGGTGAAGCTTCCAAAAATAACGGCAAAACACAAGACCACCATCATGAGGCAGGTGCCAGTTTGGGTGCCGGCAGCTTTGCAGGAACGGGTGACTTTGCCTGTGACCATGGCCTGCAGACGCTGGAGTTGCTGAAGTAAAGTCCTGTTGGTTGACTCCAGAACTTCCACCTTCTTGCGCAGCTCGCTGTTCTCAGAGGAACTATTCTCAACCCTCTTCTCCAGGCTGGTCATATATTCTTTCTTTTTCCTGCCACTCTCTTGGGCAGAAATCCTGTTTTTAATCTTTCTGCCGATCTTCTTCAGCGCCCTCCTCTCTGCCTTTGTGAGGGCATTTTTGGGGGGGGGGATGGGGGTGAACCCGGGGGCGACCACGAATTCCCCCTTCCCCTCCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAAGTCGTGTTGACCGTCC