ORFeome > crip1 ORF1 – XORFeome v1.0

crip1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: crip1
Gene ID: 953196
Gene Page ID: 953193
ORF Xenbase ID: 17270805

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078491
Original XGC clone length: 234

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ839683
dbEST ID: 79657385
Trimmed Sequence: ATGCCCAAGTGTCCCAAGTGTCAGAAAGAAGTCTACTTTGCCGAGAAGGTATCCTCCCTGGGCAAAGACTGGCACAGACCATGTCTCAAGTGTGAAAAGTGCAGCAAGACCCTTTCCCCTGGAAGCCATGCTGAGCATGATGGGAAACCTTATTGCAATCAACCATGCTATGGAGCATTGTTTGGACCAAAAGGATTTGGCCGTGGTGGAGCAGAAAGTCACTCTTACAAATT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCAAGTGTCCCAAGTGTCAGAAAGAAGTCTACTTTGCCGAGAAGGTATCCTCCCTGGGCAAAGACTGGCACAGACCATGTCTCAAGTGTGAAAAGTGCAGCAAGACCCTTTCCCCTGGAAGCCATGCTGAGCATGATGGGAAACCTTATTGCAATCAACCATGCTATGGAGCATTGTTTGGACCAAAAGGATTTGGCCGTGGTGGAGCAGAAAGTCACTCTTACAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTAAAAAAAACACGAAAAGAACATAAAACCGGCCTCAATAAACACACCAGGAAAAAAAAACAAAAGGCCTCCTCCAAACCAGGGCGGCGGGGATTTCCTTTTTTTTTCCGGGAAACCCCGGGAGCCGGGGAAAAAACCCGGGTGGAATTGGAAAGTGTGTAAAACCCCGGGGGGAACCCCCCGGGTCGGAACATAACCAAAAAAGGAAGGGGGGGGAGGGGGCCGGCGGTTTGGGGTTTTAATCTTTTTTCTTATTGGGTGTGGTGGTCCCGGCCGCCCCGGGATTTTCCAGGGGGTGGGGTTGGTTGTTTTTTTTTGGGGGGAACCCACCACCCCCCCGGGCCCCCCCCCCCCCCCAACCGCGGTTTTTGAGGGGGGGGTGGGGGGGTGTGGGTGTTTGTTTGTGGGAAACACCCGGAGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCAAGTGTCCCAAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839682
dbEST ID: 79657384
Trimmed Sequence: TTTGTAAGAGTGACTTTCTGCTCCACCACGGCCAAATCCTTTTGGTCCAAACAATGCTCCATAGCATGGTTGATTGCAATAAGGTTTCCCATCATGCTCAGCATGGCTTCCAGGGGAAAGGGTCTTGCTGCACTTTTCACACTTGAGACATGGTCTGTGCCAGTCTTTGCCCAGGGAGGATACCTTCTCGGCAAAGTAGACTTCTTTCTGACACTTGGGACACTTGGGCATGG
Full Trace Sequence: AAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGTAAGAGTGACTTTCTGCTCCACCACGGCCAAATCCTTTTGGTCCAAACAATGCTCCATAGCATGGTTGATTGCAATAAGGTTTCCCATCATGCTCAGCATGGCTTCCAGGGGAAAGGGTCTTGCTGCACTTTTCACACTTGAGACATGGTCTGTGCCAGTCTTTGCCCAGGGAGGATACCTTCTCGGCAAAGTAGACTTCTTTCTGACACTTGGGACACTTGGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCAACCTTAATACTGGCCGTCGTAATACAACATCATAGACTGGGATGTCCCTGGTAATGACAATCAGGGGCAGAAAAAAAGCAAGCGCTCCTGCCCCCCCGGGGCTTTGGGTTGGCTAATGGTGGCACGGGGAAAAGCGCGGCCTTCATGAACCCCCCGGTGTGGCGTTTGGAACCTAGAACCAAAAAAACAAACCCCCGGCCCGGCGCCTAATACATATTGGAGAAACACGGGGGGGGGGGGGGGGGGGGTTTCAAGTCTTTAGATAATTTTTTTGGGGGGGACACATATGTCCCCGGGATACACANGGCCCCCGTTACTCCGGTCGTGTTGGTGGTGGTATTTATGAGCACCAAAAATAATACGAGGGCGCGGCCGCCCGNAACACCCAAAAAAGTAAAGATGAGGTAGGATGGAGAAGGGAGGGAGGAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGTAAGAGTGACTTTCTGCTCC