ORFeome > crybb1 ORF1 – XORFeome v1.0

crybb1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: crybb1
Gene ID: 998922
Gene Page ID: 998916
ORF Xenbase ID: 17270883

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133259
Original XGC clone length: 684

Human orthology & disease relationships

NCBI Entrez ID: 1414
Ensembl gene IDs: ENSG00000100122
Directly associated (OMIM) disease MIM numbers: 611544
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ840227
dbEST ID: 79657929
Trimmed Sequence: ATGTCTCACACATCCAAACCTGCTTCTGCCAGTCATGGTGAAAAACCTGTTCCACCACCTTTTCCCATTGCCAAGCCCACAAGAAGTGGCGAGCCCCTTACTGGGACATTCAAAGTTGTGTTGTTTGAGCAGGAGAATTTTCAGGGCAGACACATGGAACTCCTGAATGAATGTGGAAACCTTGGGGAAAGGGGCTTTGACAGAGTGCGCAGTGTTATTGTCGAATCAGGACCTTGGGTTGCCTATGAACAGTCCAATTTCCGTGGTGAGATGTTTATCCTGGAGAAGGGAGAGTTTCCTCGTTGGGATACCTGGTCAAACAGCTACAGAAGCGACTGCTTTATGTCTGTTCGCCCCATCCGAATGGATAATCAGGAACATAAAATCTTCTTGTATGAAAGCACTGACTTCAAGGGCAACAAGATGGAAATAATTGAGGATGATGTGCCCAGCCTGTGGGCCTATGGTTTCTCTGACCGGGTGGGAAGCGTAAGAGTACCCTGTGGAACTTGGGTTGGATACCAATATCCAGGATATAGAGGTTACCAGTATCTGTTCAAAACCTGTGATTACAAGCATTGAAATGAATGGATTGCCTATCAACCCCAAAATCAATCCATCCGTCCTATTTAAAAAAAATCAATGGCACCAAAAGGGCCTGCTTTCGAATTGCAACAAACCAAGTTCCCACCTTTCCTGTAACAAAGTTGGCATAAAAAAAAAAAAAATTGTTTAACAATTT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTCACACATCCAAACCTGCTTCTGCCAGTCATGGTGAAAAACCTGTTCCACCACCTTTTCCCATTGCCAAGCCCACAAGAAGTGGCGAGCCCCTTACTGGGACATTCAAAGTTGTGTTGTTTGAGCAGGAGAATTTTCAGGGCAGACACATGGAACTCCTGAATGAATGTGGAAACCTTGGGGAAAGGGGCTTTGACAGAGTGCGCAGTGTTATTGTCGAATCAGGACCTTGGGTTGCCTATGAACAGTCCAATTTCCGTGGTGAGATGTTTATCCTGGAGAAGGGAGAGTTTCCTCGTTGGGATACCTGGTCAAACAGCTACAGAAGCGACTGCTTTATGTCTGTTCGCCCCATCCGAATGGATAATCAGGAACATAAAATCTTCTTGTATGAAAGCACTGACTTCAAGGGCAACAAGATGGAAATAATTGAGGATGATGTGCCCAGCCTGTGGGCCTATGGTTTCTCTGACCGGGTGGGAAGCGTAAGAGTACCCTGTGGAACTTGGGTTGGATACCAATATCCAGGATATAGAGGTTACCAGTATCTGTTCAAAACCTGTGATTACAAGCATTGAAATGAATGGATTGCCTATCAACCCCAAAATCAATCCATCCGTCCTATTTAAAAAAAATCAATGGCACCAAAAGGGCCTGCTTTCGAATTGCAACAAACCAAGTTCCCACCTTTCCTGTAACAAAGTTGGCATAAAAAAAAAAAAAATTGTTTAACAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCACACATCCAAACCT

Sequences - 3ʹ (reverse) EST

Accession: JZ840226
dbEST ID: 79657928
Trimmed Sequence: CTTGGTTGTTGCAATTACGAAGCAGCCCTTCTGGTGCCATTGATTGTCTCTAATACGACGGATGGACTGGATCTGGGGTTGATAGGCACTCCATTCATTCCAATGCTTGTAATCACAGGTTTCGAACAGATACTGGTAACCTCTATATCCTGGATATTGGTATCCAACCCAAGTTCCACAGGGTACTCTTACGCTTCCCACCCGGTCAGAGAAACCATAGGCCCACAGGCTGGGCACATCATCCTCAATTATTTCCATCTTGTTGCCCTTGAAGTCAGTGCTTTCATACAAGAAGATTTTATGTTCCTGATTATCCATTCGGATGGGGCGAACAGACATAAAGCAGTCGCTTCTGTAGCTGTTTGACCAGGTATCCCAACGAGGAAACTCTCCCTTCTCCAGGATAAACATCTCACCACGGAAATTGGACTGTTCATAGGCAACCCAAGGTCCTGATTCGACAATAACACTGCGCACTCTGTCAAAGCCCCTTTCCCCAAGGTTTCCACATTCATTCAGGAGTTCCATGTGTCTGCCCTGAAAATTCTCCTGGCTCAACAACACAACTTTGAATGTCCCAGTAGGGGGCTCCCCACTTCCTTGTGGGCTTGGGCAAGGGAAAAAGGTGGTGGAACAGGTTTTTTCCCCATAACTGGCAAAAAACAGGTTTTGGAATGTGGTGAGAAATGGGTTCCCAACTTTTTTTTGTTACAAAAGGTTGGAATTAAAAAAAAAAA
Full Trace Sequence: GACGGTAAACGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTGGTTGTTGCAATTACGAAGCAGCCCTTCTGGTGCCATTGATTGTCTCTAATACGACGGATGGACTGGATCTGGGGTTGATAGGCACTCCATTCATTCCAATGCTTGTAATCACAGGTTTCGAACAGATACTGGTAACCTCTATATCCTGGATATTGGTATCCAACCCAAGTTCCACAGGGTACTCTTACGCTTCCCACCCGGTCAGAGAAACCATAGGCCCACAGGCTGGGCACATCATCCTCAATTATTTCCATCTTGTTGCCCTTGAAGTCAGTGCTTTCATACAAGAAGATTTTATGTTCCTGATTATCCATTCGGATGGGGCGAACAGACATAAAGCAGTCGCTTCTGTAGCTGTTTGACCAGGTATCCCAACGAGGAAACTCTCCCTTCTCCAGGATAAACATCTCACCACGGAAATTGGACTGTTCATAGGCAACCCAAGGTCCTGATTCGACAATAACACTGCGCACTCTGTCAAAGCCCCTTTCCCCAAGGTTTCCACATTCATTCAGGAGTTCCATGTGTCTGCCCTGAAAATTCTCCTGGCTCAACAACACAACTTTGAATGTCCCAGTAGGGGGCTCCCCACTTCCTTGTGGGCTTGGGCAAGGGAAAAAGGTGGTGGAACAGGTTTTTTCCCCATAACTGGCAAAAAACAGGTTTTGGAATGTGGTGAGAAATGGGTTCCCAACTTTTTTTTGTTACAAAAGGTTGGAATTAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTGGTTGTTGCAATTACGAAG