ORFeome > cryga ORF1 – XORFeome v1.0

cryga ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cryga
Gene ID: 6254336
Gene Page ID: 6456569
ORF Xenbase ID: 17270901

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078553
Original XGC clone length: 528

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ839874
dbEST ID: 79657576
Trimmed Sequence: ATGGGAAAGATCTTCTTCTACGAGGAAAAGAACTTCCAAGGGCGCCACTATGAGTGCGGCTCAGACTGTTCTGACCTGTCTTCATACTTCAATCGCTGCAACTCCATCAGGGTAGAGGGTGGAAACTGGATCCTCTATGAGCACCCCAGTTACAGGGGACACCAGTATTACCTCTGGCAAGGAGAATACCCTGACTTTCAGAGGTGGATGGGCTTCAATGACTCCATCAGGTCCTGTCGATTTCTTCCCAATTACCATGGCCAATACAAAATGAGAATCTATGAAAGAGGAGACTTCCAAGGGCAGATGATGGAGTTCTTTGATGACTGCCCCAATACTTATGATCGATTCCGTTTCTATGACATTCACTCCTGCAATGTGTTTGATGGCCACTGGATGTTCTACGAGGAACCCAACTACAGGGGACGTCAGTACTACCTGAGATCTGGAGAATACAGGAGATATAATGACTGGGGAGCCTCAAGCCCAAGAATTGGCTCATTCAGAAGAGTTTATCACAGATTTTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGATCTTCTTCTACGAGGAAAAGAACTTCCAAGGGCGCCACTATGAGTGCGGCTCAGACTGTTCTGACCTGTCTTCATACTTCAATCGCTGCAACTCCATCAGGGTAGAGGGTGGAAACTGGATCCTCTATGAGCACCCCAGTTACAGGGGACACCAGTATTACCTCTGGCAAGGAGAATACCCTGACTTTCAGAGGTGGATGGGCTTCAATGACTCCATCAGGTCCTGTCGATTTCTTCCCAATTACCATGGCCAATACAAAATGAGAATCTATGAAAGAGGAGACTTCCAAGGGCAGATGATGGAGTTCTTTGATGACTGCCCCAATACTTATGATCGATTCCGTTTCTATGACATTCACTCCTGCAATGTGTTTGATGGCCACTGGATGTTCTACGAGGAACCCAACTACAGGGGACGTCAGTACTACCTGAGATCTGGAGAATACAGGAGATATAATGACTGGGGAGCCTCAAGCCCAAGAATTGGCTCATTCAGAAGAGTTTATCACAGATTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCCACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTAAAAAAATAAAAAAAAATTAATGATATCTCTGGCCCTTGTCCAATCCCGGGCAAAAAGTAAAAAAACTCCCCCCCAAAAGGGGCCCGGGGGTTCCCCTCGTTTGGTGGAGGAGAAGGGCCCCACCGGGGAAAAAACCCGCTGGGGGGGGGAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGATCTTCTTCTACGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839873
dbEST ID: 79657575
Trimmed Sequence: AAATCTGTGATAAACTCTTCTGAATGAGCCAATTCTTGGGCTTGAGGCTCCCCAGTCATTATATCTCCTGTATTCTCCAGATCTCAGGTAGTACTGACGTCCCCTGTAGTTGGGTTCCTCGTAGAACATCCAGTGGCCATCAAACACATTGCAGGAGTGAATGTCATAGAAACGGAATCGATCATAAGTATTGGGGCAGTCATCAAAGAACTCCATCATCTGCCCTTGGAAGTCTCCTCTTTCATAGATTCTCATTTTGTATTGGCCATGGTAATTGGGAAGAAATCGACAGGACCTGATGGAGTCATTGAAGCCCATCCACCTCTGAAAGTCAGGGTATTCTCCTTGCCAGAGGTAATACTGGTGTCCCCTGTAACTGGGGTGCTCATAGAGGATCCAGTTTCCACCCTCTACCCTGATGGAGTTGCAGCGATTGAAGTATGAAGACAGGTCAGAACAGTCTGAGCCGCACTCATAGTGGCGCCCCTTGGAATTCTTTTCCTCGTAGAAGAAAATCTTTCCCATGG
Full Trace Sequence: GGGAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAATCTGTGATAAACTCTTCTGAATGAGCCAATTCTTGGGCTTGAGGCTCCCCAGTCATTATATCTCCTGTATTCTCCAGATCTCAGGTAGTACTGACGTCCCCTGTAGTTGGGTTCCTCGTAGAACATCCAGTGGCCATCAAACACATTGCAGGAGTGAATGTCATAGAAACGGAATCGATCATAAGTATTGGGGCAGTCATCAAAGAACTCCATCATCTGCCCTTGGAAGTCTCCTCTTTCATAGATTCTCATTTTGTATTGGCCATGGTAATTGGGAAGAAATCGACAGGACCTGATGGAGTCATTGAAGCCCATCCACCTCTGAAAGTCAGGGTATTCTCCTTGCCAGAGGTAATACTGGTGTCCCCTGTAACTGGGGTGCTCATAGAGGATCCAGTTTCCACCCTCTACCCTGATGGAGTTGCAGCGATTGAAGTATGAAGACAGGTCAGAACAGTCTGAGCCGCACTCATAGTGGCGCCCCTTGGAATTCTTTTCCTCGTAGAAGAAAATCTTTCCCATGGTGCCAACTTTTTTGTACAAAGTTGGGATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACCAACAGGTCACATCAGTCAAAATAAAATAAATATATAAAAGACCAAAACTTAAAAATGGACCTCTTTCACAGCCCGGCATAAAAAAGGGGAAAAGTTCTTCCCCCAAGAGGTGGGGCCGGGTGTTTTTCCTTTGGTTTTTTTCGGGAAGAGGGCCACCCGAAATAGGAAAAAAACCCCGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAATCTGTGATAAACTCTTCT