ORFeome > crygb ORF1 – XORFeome v1.0

crygb ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: crygb
Gene ID: 5739683
Gene Page ID: 5739414
ORF Xenbase ID: 17270907

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078538
Original XGC clone length: 528

Human orthology & disease relationships

NCBI Entrez ID: 1419
Ensembl gene IDs: ENSG00000182187
Directly associated (OMIM) disease MIM numbers: 615188
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ839780
dbEST ID: 79657482
Trimmed Sequence: ATGGGAAAGATCTTCTTCTACGAGGACAGGAACTTCCAAGGCCGCTCTTATGAGTGTAGCTCAGAATGTTCTGACCTGTCCTCTTACTTCAATCGCTGCAACTCCATCAAGGTAGAGAATGGCAACTGGATCCTGTATGAGCAGCCCAGTTACAGGGGACACCAGTATTACCTCTGGAAAGGAGAATACCCAGACTTCCAGAGATGGATGGGCTTCAACGACTCCATCAGGTCCTGCCGCATGAGTCCCTATCACCAAGGACAATATAAAATGAGGATCTATGAAAGAGGAGACTTCCAAGGGCAGATGATGGAGTTCTTTGATGACTGCCCCAATACTTATGATCGATTCCGTTTCCATGACATTCACTCCTGCAATGTGTCTGATGGCTACTGGATGTTCTACGAGGAACCCAACTACAGGGGGCGTCAGTACTACCTGAGACCTGGACAATACAGGAGATACAATGACTGGGGAGCCTCCAGCTCCAGAATTGGTTCTTTCAGAAGAGTTCGGCAAATGTTTTT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGATCTTCTTCTACGAGGACAGGAACTTCCAAGGCCGCTCTTATGAGTGTAGCTCAGAATGTTCTGACCTGTCCTCTTACTTCAATCGCTGCAACTCCATCAAGGTAGAGAATGGCAACTGGATCCTGTATGAGCAGCCCAGTTACAGGGGACACCAGTATTACCTCTGGAAAGGAGAATACCCAGACTTCCAGAGATGGATGGGCTTCAACGACTCCATCAGGTCCTGCCGCATGAGTCCCTATCACCAAGGACAATATAAAATGAGGATCTATGAAAGAGGAGACTTCCAAGGGCAGATGATGGAGTTCTTTGATGACTGCCCCAATACTTATGATCGATTCCGTTTCCATGACATTCACTCCTGCAATGTGTCTGATGGCTACTGGATGTTCTACGAGGAACCCAACTACAGGGGGCGTCAGTACTACCTGAGACCTGGACAATACAGGAGATACAATGACTGGGGAGCCTCCAGCTCCAGAATTGGTTCTTTCAGAAGAGTTCGGCAAATGTTTTTGCCACTTTTCTTGTACAAAGTTGGCATTATAAAAAACCATTGCTTATCATTTTGTTGCAACGAACAGGTCACCTATATTCAAATTAAAATCATTATTTGCCATCCCCCTGAATTCCCCTTAAGTTGATTCGTATTAAAAAAAAAAAAAAAAAAAACATAACTCTTCTGGCGCGCCTGGGACAAACCCGGGCAAAAATCCAAAAAATTCCGCTCCCAAAAGGGGGCCGGTTGTCCTTTCCTCGGGTAATAGGGGGAAAAGGCACACACCCCGGGGGAAAAAACACCTGGCCGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGATCTTCTTCTACGA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGACAAATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAACATTTGCCAAACCCTTCTAAAAAAACCAATTCGGGAGCGGGAGGCTCCCCAGTCATTGTATCTCCGGTATTGTCCAGGTCCCAGGTAGAACGGACCCCCCCGGTATTTGGGTTCCTCGAAAAACACCCGTTACCCTTCAAACACTTTGCAGGATTGAAGGTCAGGGAAACGGAATCAATCATAATTATGGGGGCATCCATCAAAAAACTCCACCACCTGCCCTTGAAATTCCCCCCTTTCAAAAATCCCCATTTTATATTGTCCTTGGTGATAGGAACTCAGGCGGCAGGACCTGATGAATTCTTTAAACCCCACCCTCCTCTGGAATTCTGGTTATTCTCCTTTCCAAAGGTAAAACTGGTGTCCCCGGTAACTGGCCTGCTCAAACAGAATCCATTTCCCATTCTCTACCTTGATGGAGTTCCACCAATTGAATTAAAAGAACAGGTCAAAACATTCTAACCTACACCCTTAAAACCGGCCTTGAAATTTCCTGCCTCCTAAAAGAATAATCTTTCCCATGGTGCCAATTTTTTGGACCAAAGTTGGCTTTAAAAAAAACCATTGCTAACAAATTGTTTACAACAAAGAGGCAGCATACATTCGAATTAAAATAAAAAATAAAAGAAAAAAGCTATTAATTATCCGTTCTTTTTAGACGGCCGGGAACGAAAGGACCCAAAATGGCCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAACATTTGCCGAACTCTTCTG