ORFeome > crygs ORF1 – XORFeome v1.0

crygs ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: crygs
Gene ID: 6254558
Gene Page ID: 6257884
ORF Xenbase ID: 17270937

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078482
Original XGC clone length: 528

Human orthology & disease relationships

NCBI Entrez ID: 1427
Ensembl gene IDs: ENSG00000213139
Directly associated (OMIM) disease MIM numbers: 116100
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ839695
dbEST ID: 79657397
Trimmed Sequence: ATGGGAAAGATATTCTTCTACGAGGAAAAGAACTTCCAAGGCCGCCACCATGAGTGCAGCTCGGACTGTTCTGGCCTGTCCTCATACTTCAATCGCTGCAACTCCATCAGAGTAGAGGGTGGCAACTGGATCCTCTATGAGCACCCCAGTTACAGGGGACACCAGTATTACCTCTGGCAAGGAGAATACCCTGACTTTCAGAGGTGGATGGGCTTCAATGACTCCATCAGGTCCTGTCACTTTCTTCCCAATTACCCTGGCCAATACAAAATGAGAATCTATGAAAGAGGAGACTTCCAAGGGCAGATGATGGAGTTCTTTGATGACTGCCCCAATACTTATGACCGATTCCGTTTCCATGATATTCACTCCTGCAATGTGTTTGATGGCCACTGGATGTTCTATGAGGAACCCAACTATAGGGGACGTCAGTACTACCTGAGACCTGGACAATACAGGAGATACAATGACTGGGGAGCATCCAGCGCCAGAATTGGTTCTTTCAGAAGAGTTCGGCAAATGTTTTT
Full Trace Sequence: GGGCCCCAATAATAGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGATATTCTTCTACGAGGAAAAGAACTTCCAAGGCCGCCACCATGAGTGCAGCTCGGACTGTTCTGGCCTGTCCTCATACTTCAATCGCTGCAACTCCATCAGAGTAGAGGGTGGCAACTGGATCCTCTATGAGCACCCCAGTTACAGGGGACACCAGTATTACCTCTGGCAAGGAGAATACCCTGACTTTCAGAGGTGGATGGGCTTCAATGACTCCATCAGGTCCTGTCACTTTCTTCCCAATTACCCTGGCCAATACAAAATGAGAATCTATGAAAGAGGAGACTTCCAAGGGCAGATGATGGAGTTCTTTGATGACTGCCCCAATACTTATGACCGATTCCGTTTCCATGATATTCACTCCTGCAATGTGTTTGATGGCCACTGGATGTTCTATGAGGAACCCAACTATAGGGGACGTCAGTACTACCTGAGACCTGGACAATACAGGAGATACAATGACTGGGGAGCATCCAGCGCCAGAATTGGTTCTTTCAGAAGAGTTCGGCAAATGTTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGAAACATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCCAAAAACCCCCTAAAAAATTAAAAAAAAATTTTCTTCCACAAGGGGTGGCGGGTAAATTCTCCGGGTGGAAGGGAGAAAGAGCTCCCCCCCGAAGGAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGATATTCTTCTACGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839694
dbEST ID: 79657396
Trimmed Sequence: AAACATTTGCCGAACTCTTCTGAAAGAACCAATTCTGGCGCTGGATGCTCCCCAGTCATTGTATCTCCTGTATTGTCCAGGTCTCAGGTAGTACTGACGTCCCCTATAGTTGGGTTCCTCATAGAACATCCAGTGGCCATCAAACACATTGCAGGAGTGAATATCATGGAAACGGAATCGGTCATAAGTATTGGGGCAGTCATCAAAGAACTCCATCATCTGCCCTTGGAAGTCTCCTCTTTCATAGATTCTCATTTTGTATTGGCCAGGGTAATTGGGAAGAAAGTGACAGGACCTGATGGAGTCATTGAAGCCCATCCACCTCTGAAAGTCAGGGTATTCTCCTTGCCAGAGGTAATACTGGTGTCCCCTGTAACTGGGGTGCTCATAGAGGATCCATTTGCCACCCTCTACTCTCATGGAGTTGCAGCGATTGAAGTATGACGACAGGCCAGAACAGTCCGAGCTGCTCTCATGGTGGCGGCCCTGGAAGTTCTTTTCCTCCCATCAAACTAACTTTTCCCATGTGCCAAACATTTTGGTACAATTTGGCCATTTAAAAGAACCATTGCTCATCAAATTGTTTGCAACGAACAAGTCAATTATTCATTCCAAAAAAAAAAAAAAAAAAAAAAGAAAAAAACTTAAAAATGCGCCTACGGTAACAACCGGGCATAAAATGACCCAAAATGCCGCCTCCCAAAGGGGGGGGGGTGGATTCTACCGGTGTGGAAG
Full Trace Sequence: GAGTAAACTGCTAGTGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAACATTTGCCGAACTCTTCTGAAAGAACCAATTCTGGCGCTGGATGCTCCCCAGTCATTGTATCTCCTGTATTGTCCAGGTCTCAGGTAGTACTGACGTCCCCTATAGTTGGGTTCCTCATAGAACATCCAGTGGCCATCAAACACATTGCAGGAGTGAATATCATGGAAACGGAATCGGTCATAAGTATTGGGGCAGTCATCAAAGAACTCCATCATCTGCCCTTGGAAGTCTCCTCTTTCATAGATTCTCATTTTGTATTGGCCAGGGTAATTGGGAAGAAAGTGACAGGACCTGATGGAGTCATTGAAGCCCATCCACCTCTGAAAGTCAGGGTATTCTCCTTGCCAGAGGTAATACTGGTGTCCCCTGTAACTGGGGTGCTCATAGAGGATCCATTTGCCACCCTCTACTCTCATGGAGTTGCAGCGATTGAAGTATGACGACAGGCCAGAACAGTCCGAGCTGCTCTCATGGTGGCGGCCCTGGAAGTTCTTTTCCTCCCATCAAACTAACTTTTCCCATGTGCCAAACATTTTGGTACAATTTGGCCATTTAAAAGAACCATTGCTCATCAAATTGTTTGCAACGAACAAGTCAATTATTCATTCCAAAAAAAAAAAAAAAAAAAAAAGAAAAAAACTTAAAAATGCGCCTACGGTAACAACCGGGCATAAAATGACCCAAAATGCCGCCTCCCAAAGGGGGGGGGGTGGATTCTACCGGTGTGGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAACATTTGCCGAACTCTTCTG