ORFeome > cs ORF1 – XORFeome v1.0

cs ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cs
Gene ID: 943167
Gene Page ID: 943159
ORF Xenbase ID: 17270955

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046571
Original XGC clone length: 1407

Human orthology & disease relationships

NCBI Entrez ID: 1431
Ensembl gene IDs: ENSG00000062485
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,203750,231530,231670,245050,245349,248600,266150,266200,300438,312170,600858,606054,607322,609015,609975

Library Location

Plate ID: GDExl11017
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ824355
dbEST ID: 79642057
Trimmed Sequence: ATGTCGCTCATTAGCGCTGGACGTGTGTGCGCCCGTATCCTCGGAGCCAAGAACTCCCCTTGTGCTCTGATTGCTGCACGACAGGCAAGCTCTTCCACGAATCTAAAAGATGTCCTGTCAGATTTAATTCCCAAAGAACAAACTAGAATCAAGAACTTTAAGCAGCAGCATGGAAAGACGGTGATTGGGCAGGTCACTGTTGACATGGTATATGGTGGTATGCGAGGCATGAAGGGGTTGGTCTATGAAACATCTGTGCTTGACCCTGATGAGGGTATCCGTTTCCGAGGCTACAGCATTCCAGAGTGTCAGAAGTTGCTCCCCAAGGCTCCAGGAGGGGAAGAGCCATTGCCTGAGGGACTCTTCTGGCTTTTGGTGACTGGGGAGGTGCCCAATCAAGACCAGGTGAACTGGATTTCCAAGGAATGGGCAAAGAGGGCTGCTCTTCCTTCCCATGTGGTCACCATGCTGGACAACTTCCCCACCAACCTGCACCCCATGTCACAACTCAGTGCGGCCATCACTGCATTGAACAGTGAGAGCAATTTTGCACGGGCCTATGCTGAAGGGGTCAACAAAGCCAAGTACTGGGGAGTTGGTTTATGAAGATTCCATGGATCTGATTGCCAAACTTGCCTTGCGTTGCTGCAAAGATCTACCGCAATCTTTTACCGCGAGGGGAAGTAGCATCCGGCGCCCATTAATTCCCATCTAAAACGGGG
Full Trace Sequence: TATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGCTCATTAGCGCTGGACGTGTGTGCGCCCGTATCCTCGGAGCCAAGAACTCCCCTTGTGCTCTGATTGCTGCACGACAGGCAAGCTCTTCCACGAATCTAAAAGATGTCCTGTCAGATTTAATTCCCAAAGAACAAACTAGAATCAAGAACTTTAAGCAGCAGCATGGAAAGACGGTGATTGGGCAGGTCACTGTTGACATGGTATATGGTGGTATGCGAGGCATGAAGGGGTTGGTCTATGAAACATCTGTGCTTGACCCTGATGAGGGTATCCGTTTCCGAGGCTACAGCATTCCAGAGTGTCAGAAGTTGCTCCCCAAGGCTCCAGGAGGGGAAGAGCCATTGCCTGAGGGACTCTTCTGGCTTTTGGTGACTGGGGAGGTGCCCAATCAAGACCAGGTGAACTGGATTTCCAAGGAATGGGCAAAGAGGGCTGCTCTTCCTTCCCATGTGGTCACCATGCTGGACAACTTCCCCACCAACCTGCACCCCATGTCACAACTCAGTGCGGCCATCACTGCATTGAACAGTGAGAGCAATTTTGCACGGGCCTATGCTGAAGGGGTCAACAAAGCCAAGTACTGGGGAGTTGGTTTATGAAGATTCCATGGATCTGATTGCCAAACTTGCCTTGCGTTGCTGCAAAGATCTACCGCAATCTTTTACCGCGAGGGGAAGTAGCATCCGGCGCCCATTAATTCCCATCTAAAACGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGCTCATTAGCGCTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829714
dbEST ID: 79647416
Trimmed Sequence: GCCAGACTTTGAACCGACAAGCTGCATGAGGCCATCTGTGCTCATTGATTTAGGTCTTTCCAGGGGGAATCCAAGAGCTCTGCTCCAGATAAGTTGAGACAGAACACCAAGCGCCCGCGATACACCAAAGAGAACGGTGTAGTAGTTCATCTCCGTCATGCCGTAATACTGTAGGAGGACTCCACTGTGAGCATCCACATTAGGCCAGGGGTTCTTGGCTTTGCCTTGCTCCAGTAATATATTGGGAACAATCTTGTAAAGCTGAGCCACCAGTTTGAACATAGGGTCGTCTGGCAGGTGTTTCAGAGCAAATTCTCTTTGGCAAGTGTAGCGTGGGTCGGTTTTTCGCAACACAGCATGACCATATCCAGGGACAACCCTGCCAGAGTTCAGAGTGTTCCAGATGTAATCTCTCAGTTTCTCATCCGACACCTCTCCACCAAGATCCTTCTGCAGACTTGTGAGCCACACAAGAACTTCCTGGTTAGCCAGACCATGAAGAGGGCCTGCCAATCCGTTCATGGCAGCAGAAAATGAGAGATAAGGATCAGAGAGAGCACTACCCACCAAGTGGCTTGTGTGAGCACTTACGTTGCCTCCTTCGTGGTCACTATGGATCGTCAGGTAAAGTCTCATCAGCTCTTGTGATTGGTTGATCTGTGTAACCCCAACAAGGGTGGGTAAAGTTATTCAAAACCAGTCCTAGAATGGGAAATCAATTGGGCGCCCGATTCCCACTTTCCCTCTCCCGGGTTAAAAAAATG
Full Trace Sequence: GGACAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCAGACTTTGAACCGACAAGCTGCATGAGGCCATCTGTGCTCATTGATTTAGGTCTTTCCAGGGGGAATCCAAGAGCTCTGCTCCAGATAAGTTGAGACAGAACACCAAGCGCCCGCGATACACCAAAGAGAACGGTGTAGTAGTTCATCTCCGTCATGCCGTAATACTGTAGGAGGACTCCACTGTGAGCATCCACATTAGGCCAGGGGTTCTTGGCTTTGCCTTGCTCCAGTAATATATTGGGAACAATCTTGTAAAGCTGAGCCACCAGTTTGAACATAGGGTCGTCTGGCAGGTGTTTCAGAGCAAATTCTCTTTGGCAAGTGTAGCGTGGGTCGGTTTTTCGCAACACAGCATGACCATATCCAGGGACAACCCTGCCAGAGTTCAGAGTGTTCCAGATGTAATCTCTCAGTTTCTCATCCGACACCTCTCCACCAAGATCCTTCTGCAGACTTGTGAGCCACACAAGAACTTCCTGGTTAGCCAGACCATGAAGAGGGCCTGCCAATCCGTTCATGGCAGCAGAAAATGAGAGATAAGGATCAGAGAGAGCACTACCCACCAAGTGGCTTGTGTGAGCACTTACGTTGCCTCCTTCGTGGTCACTATGGATCGTCAGGTAAAGTCTCATCAGCTCTTGTGATTGGTTGATCTGTGTAACCCCAACAAGGGTGGGTAAAGTTATTCAAAACCAGTCCTAGAATGGGAAATCAATTGGGCGCCCGATTCCCACTTTCCCTCTCCCGGGTTAAAAAAATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCAGACTTTGAACCGAC