ORFeome > csnk1g3 ORF1 – XORFeome v1.0

csnk1g3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: csnk1g3
Gene ID: 865237
Gene Page ID: 479073
ORF Xenbase ID: 17271015

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129058
Original XGC clone length: 1275

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: JZ837439
dbEST ID: 79655141
Trimmed Sequence: ATGGATGGCAAGAAGAAAGACAAGGACAAACCTGATGAAAGAATGGCCCGGCCAAGTGGCCGTTCAGGTCACAACACACGTGGTACTGGATCTTCGAACTCTGGAGTATTAATGGTCGGGCCTAATTTTAGAGTTGGAAAAAAAATTGGTTGTGGCAATTTTGGAGAACTCAGATTAGGAAAAAACCTGTACACAAATGAATATGTGGCAATTAAATTGGAACCAATGAAATCCAGAGCACCGCAACTACATTTGGAATATAGGTTCTACAAGCAGCTAGGATCTGGAGATGGTGTACCTCAGGTTTACTATTTTGGCCCTTGTGGTAAATATAATGCCATGGTGCTAGAGCTACTAGGCCCAAGCTTGGAAGACTTGTTTGACTTGTGCGACCGAACATTTTCCCTCAAGACCGTTCTTATGATAGCCATACAGTTGATATCCCGCATGGAATATGTTCACTCCAAGAATTTGATTTATAGAGATGTAAAACCTGAAAACTTCTTAATAGGCCGACCAGGAAACAAGAACCAGCAGATCATTCACATTATAGATTTTGGATTGGCAAAAGAATACATAGATCCAGAAACAAAGAAGCACATACCATACAGAGAACACAAGAGCCTTACGGGAACTGCTAGATACATGAGTATTAATACACATCTAGGGAAAAGACCAAAGTAAAAAAGATGATTTAAAAACCTTAAGGGCATATGTTTCATGTATTTCCCTGCCGAGCCGGCTTACCCGTGGCCAAAGGCTTGGAAGGGCTGAACCCTTTAAAAAAAAAAAAATTTCAAAAAAAATTGAAAAAAACACAAAAAAAAAAA
Full Trace Sequence: CGAGGGGCCCAATAATTGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGGCAAGAAGAAAGACAAGGACAAACCTGATGAAAGAATGGCCCGGCCAAGTGGCCGTTCAGGTCACAACACACGTGGTACTGGATCTTCGAACTCTGGAGTATTAATGGTCGGGCCTAATTTTAGAGTTGGAAAAAAAATTGGTTGTGGCAATTTTGGAGAACTCAGATTAGGAAAAAACCTGTACACAAATGAATATGTGGCAATTAAATTGGAACCAATGAAATCCAGAGCACCGCAACTACATTTGGAATATAGGTTCTACAAGCAGCTAGGATCTGGAGATGGTGTACCTCAGGTTTACTATTTTGGCCCTTGTGGTAAATATAATGCCATGGTGCTAGAGCTACTAGGCCCAAGCTTGGAAGACTTGTTTGACTTGTGCGACCGAACATTTTCCCTCAAGACCGTTCTTATGATAGCCATACAGTTGATATCCCGCATGGAATATGTTCACTCCAAGAATTTGATTTATAGAGATGTAAAACCTGAAAACTTCTTAATAGGCCGACCAGGAAACAAGAACCAGCAGATCATTCACATTATAGATTTTGGATTGGCAAAAGAATACATAGATCCAGAAACAAAGAAGCACATACCATACAGAGAACACAAGAGCCTTACGGGAACTGCTAGATACATGAGTATTAATACACATCTAGGGAAAAGACCAAAGTAAAAAAGATGATTTAAAAACCTTAAGGGCATATGTTTCATGTATTTCCCTGCCGAGCCGGCTTACCCGTGGCCAAAGGCTTGGAAGGGCTGAACCCTTTAAAAAAAAAAAAATTTCAAAAAAAATTGAAAAAAACACAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGGCAAGAAGAAAGACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837438
dbEST ID: 79655140
Trimmed Sequence: TTTGTGGCGTTGAATAGTTTTCCTTTTCCTTCTCTTGAAAAAGCAACAGCACCACATGTTCAACACTTTCTGGCAGTTTGTTTCATCTAGGACTTCCACCTCGGCTGGGGCTGTGATCGGTGCATTTGAGTGCCCTGCTGTTGGATCGTCCGTGTTTAGCTCACCGTTTGTAGAACTTACAACCTGATTTTTGGCTTGCTGCATTTTATCTCTATGTTGATGTGCTTCTCTGTTTGATGAAAGTGCAGGGTCTGCATGGATAGGTCCAACAGGTGTAGGCAGTTGCTTTCCAATCCAGTCATATTCATAATCAAACATATATCCTTTACGATCAAACAAATCGGTAAAAAGTTTTCTTAAGTAGTCATAGTCAGGCTTCTCAAAAAAGTCTAGTCTTCTTACATAGCGTAAATATGTTGCCATCTCTTCTGGGAAGTTCTCACAAAGCACTTCAATTGGTGTTGATCTCTTTGTGTCTCCGATTTTTTGATATCTTTCTTTTAATGTGTCAGCCGTCAAGCCTTGCCACAGTAGGCTGCCCCCCAGGAAAAACATGAAAAAATACCCCAATGCTTCTAAGGCATCTCTTCTACTTTTCTCTTTTTCGAGATTTTGTATTAAAACTCAAAGAAACCAAAACAGTCCCTTAAAAGCTCCTTGGGTTCGCTGTGGGGGTACTTTCGTGCTTGGTTGGCGGAGGTCAAGGGGGTGGGGGTGGGCGGGGCGCGGAGCTGAGAAAAAAAAAAAA
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGTGGCGTTGAATAGTTTTCCTTTTCCTTCTCTTGAAAAAGCAACAGCACCACATGTTCAACACTTTCTGGCAGTTTGTTTCATCTAGGACTTCCACCTCGGCTGGGGCTGTGATCGGTGCATTTGAGTGCCCTGCTGTTGGATCGTCCGTGTTTAGCTCACCGTTTGTAGAACTTACAACCTGATTTTTGGCTTGCTGCATTTTATCTCTATGTTGATGTGCTTCTCTGTTTGATGAAAGTGCAGGGTCTGCATGGATAGGTCCAACAGGTGTAGGCAGTTGCTTTCCAATCCAGTCATATTCATAATCAAACATATATCCTTTACGATCAAACAAATCGGTAAAAAGTTTTCTTAAGTAGTCATAGTCAGGCTTCTCAAAAAAGTCTAGTCTTCTTACATAGCGTAAATATGTTGCCATCTCTTCTGGGAAGTTCTCACAAAGCACTTCAATTGGTGTTGATCTCTTTGTGTCTCCGATTTTTTGATATCTTTCTTTTAATGTGTCAGCCGTCAAGCCTTGCCACAGTAGGCTGCCCCCCAGGAAAAACATGAAAAAATACCCCAATGCTTCTAAGGCATCTCTTCTACTTTTCTCTTTTTCGAGATTTTGTATTAAAACTCAAAGAAACCAAAACAGTCCCTTAAAAGCTCCTTGGGTTCGCTGTGGGGGTACTTTCGTGCTTGGTTGGCGGAGGTCAAGGGGGTGGGGGTGGGCGGGGCGCGGAGCTGAGAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGTGGCGTTGAATAGTTTTCCT