ORFeome > csrp1 ORF1 – XORFeome v1.0

csrp1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: csrp1
Gene ID: 941453
Gene Page ID: 941447
ORF Xenbase ID: 17271045

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081239
Original XGC clone length: 582

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ839854
dbEST ID: 79657556
Trimmed Sequence: ATGCCTAACTGGGGAGGAGGAAAGAAATGTTCAGTGTGCCAGAAGTCTGTTTACTTTGCAGAAGAGGTACAGTGCGAGGGAGGAAGCTTCCACAAGTCCTGTTTCTTATGCATGGCATGTAAAAAGAATTTAGATAGCACTACAGTAGCAATTCATGGAGAAGAGATTTACTGCAAATCCTGTTATGGCAAGAAGTATGGTCCCAAAGGCTATGGGTTTGGCCAGGGAGCAGGTACTCTGAGCATGGATCGAGGAGAGCACTTGGGCATCCGATCTGATGAACCTTCAAGACACCAACCAACAAATAACCCAAATGCTTCGAAGTTTGCACAGAATGTGGGAGGTGCAGACATTTGCCCTCGCTGTTCGAAATCTGTGTATGCTGCTGAAAAAGTTATTGGTGCAGGCAATTCTTGGCACAAGTCCTGCTTTCGCTGTTCTAAATGTGGAAAAGGCTTGGAATCCACAACAGTGGCTGATAGAGACGGTGACATATTTTGCAAAGCTTGCTATGCAAAGAATTTTGGGCCAAAAGGATTCGGGTTCGGTCAAGGTGCTGGAGCTTTGGCCCACACAGAGTT
Full Trace Sequence: GGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTAACTGGGGAGGAGGAAAGAAATGTTCAGTGTGCCAGAAGTCTGTTTACTTTGCAGAAGAGGTACAGTGCGAGGGAGGAAGCTTCCACAAGTCCTGTTTCTTATGCATGGCATGTAAAAAGAATTTAGATAGCACTACAGTAGCAATTCATGGAGAAGAGATTTACTGCAAATCCTGTTATGGCAAGAAGTATGGTCCCAAAGGCTATGGGTTTGGCCAGGGAGCAGGTACTCTGAGCATGGATCGAGGAGAGCACTTGGGCATCCGATCTGATGAACCTTCAAGACACCAACCAACAAATAACCCAAATGCTTCGAAGTTTGCACAGAATGTGGGAGGTGCAGACATTTGCCCTCGCTGTTCGAAATCTGTGTATGCTGCTGAAAAAGTTATTGGTGCAGGCAATTCTTGGCACAAGTCCTGCTTTCGCTGTTCTAAATGTGGAAAAGGCTTGGAATCCACAACAGTGGCTGATAGAGACGGTGACATATTTTGCAAAGCTTGCTATGCAAAGAATTTTGGGCCAAAAGGATTCGGGTTCGGTCAAGGTGCTGGAGCTTTGGCCCACACAGAGTTGCCAACTTTCTTGTACAAAATTGGCATTATAAAAAAGTGGTGTGCTATCAATTTTTTGCAACGAACAGGTCCCTATCAATCAAAATAAAATCCTTATTTGCCATCCCCCCTTAAAACCCCTTTTATGGAGTTCTAATACCATGGCCCCTAAAAAAAAAAAAAAAAAAACAACAGAAAACGTTTTCCAAAAACTCCCGGGAAGGCTAAAACACAAAAAGATAAAAAACCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTAACTGGGGAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839853
dbEST ID: 79657555
Trimmed Sequence: CTCTGTGTGGGCCAAAGCTCCAGCACCTTGACCGAACCCGAATCCTTTTGGCCCAAAATTCTTTGCATAGCAAGCTTTGCAAAATATGTCACCGTCTCTATCAGCCACTGTTGTGGATTCCAAGCCTTTTCCACATTTAGAACAGCGAAAGCAGGACTTGTGCCAAGAATTGCCTGCACCAATAACTTTTTCAGCAGCATACACAGATTTCGAACAGCGAGGGCAAATGTCTGCACCTCCCACATTCTGTGCAAACTTCGAAGCATTTGGGTTATTTGTTGGTTGGTGTCTTGAAGGTTCATCAGATCGGATGCCCAAGTGCTCTCCTCGATCCATGCTCAGAGTACCTGCTCCCTGGCCAAACCCATAGCCTTTGGGACCATACTTCTTGCCATAACAGGATTTGCAGTAAATCTCTTCTCCATGAATTGCTACTGTAGTGCTATCTAAATTCTTTTTACATGCCATGCATAAGAAACAGGACTTGTGGAAGCTTCCTCCCTCGCACTGTACCTCTTCTGCAAAGTAAACAGACTTCTGGCACACTGAACATTTCTTTCCTCCCCCCCAGTTAGGCATGG
Full Trace Sequence: GGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTGTGTGGGCCAAAGCTCCAGCACCTTGACCGAACCCGAATCCTTTTGGCCCAAAATTCTTTGCATAGCAAGCTTTGCAAAATATGTCACCGTCTCTATCAGCCACTGTTGTGGATTCCAAGCCTTTTCCACATTTAGAACAGCGAAAGCAGGACTTGTGCCAAGAATTGCCTGCACCAATAACTTTTTCAGCAGCATACACAGATTTCGAACAGCGAGGGCAAATGTCTGCACCTCCCACATTCTGTGCAAACTTCGAAGCATTTGGGTTATTTGTTGGTTGGTGTCTTGAAGGTTCATCAGATCGGATGCCCAAGTGCTCTCCTCGATCCATGCTCAGAGTACCTGCTCCCTGGCCAAACCCATAGCCTTTGGGACCATACTTCTTGCCATAACAGGATTTGCAGTAAATCTCTTCTCCATGAATTGCTACTGTAGTGCTATCTAAATTCTTTTTACATGCCATGCATAAGAAACAGGACTTGTGGAAGCTTCCTCCCTCGCACTGTACCTCTTCTGCAAAGTAAACAGACTTCTGGCACACTGAACATTTCTTTCCTCCCCCCCAGTTAGGCATGGTGCCAACTTTTTTGTACAAGTTTGCATTATTAAAAAACATTGCTCATCAATTTGTTGCAACGAATAGGGTCACTATCATTTAAAAATAAAAAACATAATTAAAAAAAACAGAAGCTTAAAAACGGGCCGTCATTTACAAAACCCTCTGGGAAACGGGGGGAATTTCCCTGCGCCCCCCTGGCTGCCCTGGGTTGTTGTTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTGTGTGGGCCAAAGCTC