ORFeome > cst7 ORF1 – XORFeome v1.0

cst7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cst7
Gene ID: 6255508
Gene Page ID: 945285
ORF Xenbase ID: 17271069

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC130168
Original XGC clone length: 450

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ838503
dbEST ID: 79656205
Trimmed Sequence: ATGTCTTGTGTCTGGCTCATGTTACCTCTTTTCATTCTCACCATGTACATCTGCACAGGGACTTACTGTGCTCTGGACTTCCAGTTGACAACAGTTGACCCCGGCTTCCCCAAAAATATCACCACAAATGATCCCGCAGTTCAAAAGGCGGCACGGGTAACAGTATATGCGTATAACAACAAGTCCAATGACAGCTTTCTCTTTAAAAACCTGGAGGTTCAAAAGGCTATAATTCAAATTGTAAAAGGCATAAAATACCTACTGCAAACTAAAATAGGAAAAACCGTCTGTCCAAAAAAGGAGTTCTACAACTTGAATCAATGTGACTTTCAGCAGGACAGCCCTCTCAAGCAAACCTTCACATGCTATTCTAAGGTTTGGAACATTACCTGGCTTCATGTGAAAACTGTTCCAGTGCTTCGCTGCCAAAAATTGAACTGAAGTGATTT
Full Trace Sequence: CTCGCGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTTGTGTCTGGCTCATGTTACCTCTTTTCATTCTCACCATGTACATCTGCACAGGGACTTACTGTGCTCTGGACTTCCAGTTGACAACAGTTGACCCCGGCTTCCCCAAAAATATCACCACAAATGATCCCGCAGTTCAAAAGGCGGCACGGGTAACAGTATATGCGTATAACAACAAGTCCAATGACAGCTTTCTCTTTAAAAACCTGGAGGTTCAAAAGGCTATAATTCAAATTGTAAAAGGCATAAAATACCTACTGCAAACTAAAATAGGAAAAACCGTCTGTCCAAAAAAGGAGTTCTACAACTTGAATCAATGTGACTTTCAGCAGGACAGCCCTCTCAAGCAAACCTTCACATGCTATTCTAAGGTTTGGAACATTACCTGGCTTCATGTGAAAACTGTTCCAGTGCTTCGCTGCCAAAAATTGAACTGAAGTGATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACAAACAGGTCACTATCATTCAAAATAAAATCATTATTTGCCATCCACCTAATATCCCCTATATTGAGTCTTATTACATGGTCAAAACTTTTTCAAAAAAAAAATAAAACGAATCTAAAAATCCCAAAATTTAAACCCCGCCGGCTTGNNNTCCGCGGTCCCCCCCTCCCCGTGGGGTGTTGTGTTTTCCTGTGTTTTTGTGGGCGGTCCCCCGCAAAAAAAAAAAAAAAAATAAAGAAAAATATAAAAAAATATAAAACAACCATCCCCCTAAGTTGACATATCTCAATATTAATAAAAGAGGAGAGTCGGGTCGTTTAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTGTGTCTGGCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838502
dbEST ID: 79656204
Trimmed Sequence: ATCACTCCAGTCCAATTCTTGGCAGCGAAGCACTGGAACAGTTTCCACATGAAGCCAGGTAATGTTCCAAACCTCAGAATAGCATGTGAAGGTCTGCTTGAGAGGGCTGTCCTGCTGAAAGTCACATTGATCCAAGTTGTAGAACTCCTTTTTTGGACAGACGGTTCTTCCTATCTTAGTCTGCAGTAGGTATTTTATGCCTTTTACAATCTGAATCATAGCCTTTTGAACCTCCAGGTCTTTAAAGAGAAAGCTGTCATTGGACTTGTTGTTATACGCATATACTGTTACCCGTGCCGCCTTTTGAACTGCGGGATCATTTGTGCTGATATTTCTGGGGAAGCCGGGGTCAACTGTTGTCAACTGGAAGTCCAGAGCACAGTAAGTCCCTGTGCAGATGTACATGGTGAGAATGAAAAGAGGTAACATGAGCCAGACACAAGACATGG
Full Trace Sequence: AAACTGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCACTCCAGTCCAATTCTTGGCAGCGAAGCACTGGAACAGTTTCCACATGAAGCCAGGTAATGTTCCAAACCTCAGAATAGCATGTGAAGGTCTGCTTGAGAGGGCTGTCCTGCTGAAAGTCACATTGATCCAAGTTGTAGAACTCCTTTTTTGGACAGACGGTTCTTCCTATCTTAGTCTGCAGTAGGTATTTTATGCCTTTTACAATCTGAATCATAGCCTTTTGAACCTCCAGGTCTTTAAAGAGAAAGCTGTCATTGGACTTGTTGTTATACGCATATACTGTTACCCGTGCCGCCTTTTGAACTGCGGGATCATTTGTGCTGATATTTCTGGGGAAGCCGGGGTCAACTGTTGTCAACTGGAAGTCCAGAGCACAGTAAGTCCCTGTGCAGATGTACATGGTGAGAATGAAAAGAGGTAACATGAGCCAGACACAAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGGCCCAAGCATAAAACAAAAAAAACTTTACAAGTAATATTAACAAGGGANGNGAGGAANNNGAAAAGAAAAATTGCTCTTCTTCGCGGGTTGAGGGGGTTGTTTGATTTTTTAAAAAAAAAAAAAACAAACAAACAAAACAAAAAAAACGACTCAGAAAAGGAAGAAAAAAGAGACCCCCCGGGGGGNNNNACACACCAAGNNNGGANNNNNGGGCGGGGAGGNAGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCACTCCAGTCCAATTCTTG