ORFeome > cstf1 ORF1 – XORFeome v1.0

cstf1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cstf1
Gene ID: 970054
Gene Page ID: 970047
ORF Xenbase ID: 17271075

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043798
Original XGC clone length: 1296

Human orthology & disease relationships

NCBI Entrez ID: 1477
Ensembl gene IDs: ENSG00000101138
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,609065,609227

Library Location

Plate ID: GDExl11012
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: JZ823971
dbEST ID: 79641673
Trimmed Sequence: ATGTTTCGGTACAAGATTACCCTTAAAGATCGGCAGCAGTTGTACAAACTGATCATCGGCCAGATGCTCTACGATGGCTACATCAACATTGCCAACGGCCTCATCAATGAACTCAAGCTCCATTCTGTGTGCTCCCCGTCTGAGCAGCTGCTCCATCTCATCAAAGTGGGTATGGAGAATGATGACAGTGCGGTGCAGTATGCCATTGGACGCTCTGACACAGTAGCCCCAGGCACAGGAATCGATTTGGAATTTGATGCAGATGTACAAACCATGTCTCCTGAAGCCTCTGAGTACGAGACCTGCTATGTGACATCCCATAAAGGACCTTGCCGGGTGGCCACGTACAGCAGAGATGGGCAGCTCATTGCTACTGGCTCAGCTGATGCTTCTATCAAGATCCTCGATACAGAGAGAATGCTGGCAAAAAGTGCAATGCCGATCGAGGTGATGATGAACGAGACTGCACAGCAGAATATGGAGAATCACCCGGTCATTCGCACTCTCTATGATCACGTTGATGAGGTCACCTGTCTGGCGTTCCACCCCACTGAACAGATCCTGGCGTCCGGCTCCAAAGATTACACCCTCAAACTCTTTGACTATTCCAAACCTTCTGCCAAAAGAGCCTTTAAATACATCCAGGAAGCGGAAATGCTGCGCTCTATCTCGTTTCACCCGTCTGGAGACTTCATTAATAGTCGGTACCAAACACCCCCACCTGCCGCTCCACGATATCAACACCCTCCCATGGGCTTTTGGTCCGGCAAATCCCCCAGGA
Full Trace Sequence: AATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTCGGTACAAGATTACCCTTAAAGATCGGCAGCAGTTGTACAAACTGATCATCGGCCAGATGCTCTACGATGGCTACATCAACATTGCCAACGGCCTCATCAATGAACTCAAGCTCCATTCTGTGTGCTCCCCGTCTGAGCAGCTGCTCCATCTCATCAAAGTGGGTATGGAGAATGATGACAGTGCGGTGCAGTATGCCATTGGACGCTCTGACACAGTAGCCCCAGGCACAGGAATCGATTTGGAATTTGATGCAGATGTACAAACCATGTCTCCTGAAGCCTCTGAGTACGAGACCTGCTATGTGACATCCCATAAAGGACCTTGCCGGGTGGCCACGTACAGCAGAGATGGGCAGCTCATTGCTACTGGCTCAGCTGATGCTTCTATCAAGATCCTCGATACAGAGAGAATGCTGGCAAAAAGTGCAATGCCGATCGAGGTGATGATGAACGAGACTGCACAGCAGAATATGGAGAATCACCCGGTCATTCGCACTCTCTATGATCACGTTGATGAGGTCACCTGTCTGGCGTTCCACCCCACTGAACAGATCCTGGCGTCCGGCTCCAAAGATTACACCCTCAAACTCTTTGACTATTCCAAACCTTCTGCCAAAAGAGCCTTTAAATACATCCAGGAAGCGGAAATGCTGCGCTCTATCTCGTTTCACCCGTCTGGAGACTTCATTAATAGTCGGTACCAAACACCCCCACCTGCCGCTCCACGATATCAACACCCTCCCATGGGCTTTTGGTCCGGCAAATCCCCCAGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTCGGTACAAGATTACCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829280
dbEST ID: 79646982
Trimmed Sequence: GTCTGTCGTTGACCTGCGGTACCAGAACCTGGCCCGAAAATCATCGCTGCAGGTCATAAAGCCGGGATTAGTCGGAGAATGAACAATGCAGCGTACTATGTTGTTGTGTCCCAAGGAGAGAAGATTTCGCCGTTCTGAGGTCCTGGAATCCCAGCAGCAAAGGCTTATGGTCCGTTCATCCGGAAGGAGGACATAGTCTTCTGTGTGGTTGAACACGGCTTGTGTTCTGTGTACTTGTCTCCCGCTGAGTCCGGCTCCTGTGTATTTTACCATCATTCGCCCCGTTGAGATCTCCCATAATCTTCCCACGGAGTCTTTGCCGCTGGACAGGATGTACTTGGAATTCTTGGAGAATATGGCAGAACACACTTCTGCGCCATCGTGGGCCTTTTCATAGGTGGTGATGCAGCGGTTGGAGACGCCGTCCCACAGCTTGATGCTGCCGTCCTTGCTGCAGGTGACGTAAGTGTTGGCGGTTGGGTTATAGCTGACCGAGCAGATGGCGTCCGTGTGCTGATCCTGGGGATTGCAGGACACAAAGCACTGGAAGGTGTTGATATCGTAGAGGCGCAGGGTGGGGGTGTTGGGTACCGACTATAATGAAGTCTCCAGACGGGTGGGAACGAGATAGAACGCACCATTTTCCCCTTCCGGGATGTATTTAAAGGGCTCTTTTGGGCAAAAGGGTTGGGAATAAGTCAAAAAAGTTTGAGGGGGGGTAAACCTTTGGGGAGGCCGGAAAGCCCGGGG
Full Trace Sequence: TGCCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTGTCGTTGACCTGCGGTACCAGAACCTGGCCCGAAAATCATCGCTGCAGGTCATAAAGCCGGGATTAGTCGGAGAATGAACAATGCAGCGTACTATGTTGTTGTGTCCCAAGGAGAGAAGATTTCGCCGTTCTGAGGTCCTGGAATCCCAGCAGCAAAGGCTTATGGTCCGTTCATCCGGAAGGAGGACATAGTCTTCTGTGTGGTTGAACACGGCTTGTGTTCTGTGTACTTGTCTCCCGCTGAGTCCGGCTCCTGTGTATTTTACCATCATTCGCCCCGTTGAGATCTCCCATAATCTTCCCACGGAGTCTTTGCCGCTGGACAGGATGTACTTGGAATTCTTGGAGAATATGGCAGAACACACTTCTGCGCCATCGTGGGCCTTTTCATAGGTGGTGATGCAGCGGTTGGAGACGCCGTCCCACAGCTTGATGCTGCCGTCCTTGCTGCAGGTGACGTAAGTGTTGGCGGTTGGGTTATAGCTGACCGAGCAGATGGCGTCCGTGTGCTGATCCTGGGGATTGCAGGACACAAAGCACTGGAAGGTGTTGATATCGTAGAGGCGCAGGGTGGGGGTGTTGGGTACCGACTATAATGAAGTCTCCAGACGGGTGGGAACGAGATAGAACGCACCATTTTCCCCTTCCGGGATGTATTTAAAGGGCTCTTTTGGGCAAAAGGGTTGGGAATAAGTCAAAAAAGTTTGAGGGGGGGTAAACCTTTGGGGAGGCCGGAAAGCCCGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTGTCGTTGACCTGCGGTA