ORFeome > ctbs ORF1 – XORFeome v1.0

ctbs ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ctbs
Gene ID: 975897
Gene Page ID: 975890
ORF Xenbase ID: 17271105

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053782
Original XGC clone length: 1113

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ839106
dbEST ID: 79656808
Trimmed Sequence: ATGGCAGAACTCGGTTCAGGGTATTGGGCCCTCAGCCCACTTTTTATCATGCTCATCTGTGTATCCCTGTGTTCTGCTGGCTGCCCCTGTACAGACCCCAGTCTCTGTGAGCCCATTAACAGCACCCGGGATTCTGAGGTGCTCGTATTCTACACAAGAGGAGAAAACTGGAAGTTCTATGATTGGTCTCAGGTTACCACCATCGCATTGTTTGGGAAGTATGATCCACAACTCCTGTGTTTTGCACATTTGAAAGGAGCAAGGCTTGTATTAAAAGGTGATGTTCCACTACAGGACATTGTAGATCCAAATAACAGAACATCTTGGATAGCGCAGAAGGTGGAACTGGCAAAGAGTCAGTTTATGGATGGAATTAATCTGGATATAGAGCAGTCAGTGCTGAAAGGTTCACCTGAGTATTATGGATTAACTGCATTGGTTCAAGAAACTACTGAGGCTTTCCACAGAGAAATCCCTGGCTCCCAGGTAACATTTGATGTGGCATGGTGTCCCGACTGTGTGGATGGAAGATGCTACAATTACACAGGGATTGCGGAATCATGTGATTTCATTTTTGTTATGTCATACGATGAGCATTCACAGATATGGACAGAGTGTGAGGCAGGGGCCACTTCCTCTCTTCATAAAACAATCTCAAGTTTATAAAGGTTCCATTCTTTTGGGTATTGAACCGCGAAAAACTGATAAAAGGGTTGTCCCTTGGTTATGTTTTTTAACTTACCCATTCCCTGGAAATTATTTTTGGGGAATAAACAAAAGGACACTATTAAAAGGGAGGGCCCCCCTAT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGAACTCGGTTCAGGGTATTGGGCCCTCAGCCCACTTTTTATCATGCTCATCTGTGTATCCCTGTGTTCTGCTGGCTGCCCCTGTACAGACCCCAGTCTCTGTGAGCCCATTAACAGCACCCGGGATTCTGAGGTGCTCGTATTCTACACAAGAGGAGAAAACTGGAAGTTCTATGATTGGTCTCAGGTTACCACCATCGCATTGTTTGGGAAGTATGATCCACAACTCCTGTGTTTTGCACATTTGAAAGGAGCAAGGCTTGTATTAAAAGGTGATGTTCCACTACAGGACATTGTAGATCCAAATAACAGAACATCTTGGATAGCGCAGAAGGTGGAACTGGCAAAGAGTCAGTTTATGGATGGAATTAATCTGGATATAGAGCAGTCAGTGCTGAAAGGTTCACCTGAGTATTATGGATTAACTGCATTGGTTCAAGAAACTACTGAGGCTTTCCACAGAGAAATCCCTGGCTCCCAGGTAACATTTGATGTGGCATGGTGTCCCGACTGTGTGGATGGAAGATGCTACAATTACACAGGGATTGCGGAATCATGTGATTTCATTTTTGTTATGTCATACGATGAGCATTCACAGATATGGACAGAGTGTGAGGCAGGGGCCACTTCCTCTCTTCATAAAACAATCTCAAGTTTATAAAGGTTCCATTCTTTTGGGTATTGAACCGCGAAAAACTGATAAAAGGGTTGTCCCTTGGTTATGTTTTTTAACTTACCCATTCCCTGGAAATTATTTTTGGGGAATAAACAAAAGGACACTATTAAAAGGGAGGGCCCCCCTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAACTCGGTTCAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839105
dbEST ID: 79656807
Trimmed Sequence: ATTTCCTTGCCCCTTTAAGGCATTCCACATGCTTTTAGTTTGAGTCTCAGCTATGGGATTCCTTGAGTAATCTAGTAGATCTCCATTCCACATGCCTATGCCTCTCAATCCGTGTATCTTCACATATGCAGATTTCAGGGAGATGCTCACTGGATCATCATACCAAACTTGATGTAACTGCCCCTTTGCATCCTTGTAATTATAAAAAGGGGATTTCTGTACATCATCCCATAGCCTTCCAGTAAGAGAACTGTTGACCTGCTTCATGATCTTACTGTATGGGATCTGCCGCCCTGCTGCATCACTGCAAGGTGCTCCCCGGAATGGGACCTCCTTAATAGTACATTTGTTATCCTGAAATAATTCCAGGCATGGGTAGTCATATCCATACCAAGGGACACCCATTACCAGCTTCTTGGGCTCAATCCCCAACTGAATGAACTTTTCATAACCTGAGATTGTTTTATTGAGAGGAGAATTGGCCCCTGCCTCACACTCTGTCCATATCTGTGATTGCTCATCGTATGACATAACAAAAATGAAATCACATGATTCCGCAATCCCTGTGTAAATGTAGCATCTTCCATCCACACAGTCGGGACACCATGCCACAACAAAGGTTACCTGGGAGCCAGGGATTTCTCTGTGGAAAAGCCTCAATAATTTCCTTGAACCAATGCAGTTAATCCCATAAAACTCAAGGTGAAACCTTTTAACCCCTGAACTTGCTC
Full Trace Sequence: GCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTTCCTTGCCCCTTTAAGGCATTCCACATGCTTTTAGTTTGAGTCTCAGCTATGGGATTCCTTGAGTAATCTAGTAGATCTCCATTCCACATGCCTATGCCTCTCAATCCGTGTATCTTCACATATGCAGATTTCAGGGAGATGCTCACTGGATCATCATACCAAACTTGATGTAACTGCCCCTTTGCATCCTTGTAATTATAAAAAGGGGATTTCTGTACATCATCCCATAGCCTTCCAGTAAGAGAACTGTTGACCTGCTTCATGATCTTACTGTATGGGATCTGCCGCCCTGCTGCATCACTGCAAGGTGCTCCCCGGAATGGGACCTCCTTAATAGTACATTTGTTATCCTGAAATAATTCCAGGCATGGGTAGTCATATCCATACCAAGGGACACCCATTACCAGCTTCTTGGGCTCAATCCCCAACTGAATGAACTTTTCATAACCTGAGATTGTTTTATTGAGAGGAGAATTGGCCCCTGCCTCACACTCTGTCCATATCTGTGATTGCTCATCGTATGACATAACAAAAATGAAATCACATGATTCCGCAATCCCTGTGTAAATGTAGCATCTTCCATCCACACAGTCGGGACACCATGCCACAACAAAGGTTACCTGGGAGCCAGGGATTTCTCTGTGGAAAAGCCTCAATAATTTCCTTGAACCAATGCAGTTAATCCCATAAAACTCAAGGTGAAACCTTTTAACCCCTGAACTTGCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTTCCTTGCCCCTTTAAGGCAT