ORFeome > ctdspl ORF1 – XORFeome v1.0

ctdspl ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ctdspl
Gene ID: 1013062
Gene Page ID: 1013060
ORF Xenbase ID: 17271135

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123151
Original XGC clone length: 831

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ838079
dbEST ID: 79655781
Trimmed Sequence: ATGGACAACACGTCCATCATCACCCAGGTCTCTAACCCCAAGGAGGAGGGAATCCTGTCCTGTGCCCAGGAAAAGGTCTCCCAATGCAATATTAGCCTAAAAAAGCAAAGGAACAGAAGCATCTTCGGCTCCTTATTCTGCTGTTTCCGTAGTTACAGCGTAGAGCCACCAAACTCGAATAATAACAGTAGCCCTCTTCCTCCGCTGGTGGAAGAAAATGGGGGCATTCAGAAGGGTGATCAGACTCAAGCCCTTACCATTCCCAGTCCACCTACTAAATACCTCCTTCCTGAACTGAAAGTATCCGAATATGGGAAGAAGTGCGTGGTCATTGACCTGGATGAAACCTTAGTGCACAGTTCATTTAAGCCTATAAACAACGCAGACTTCATTGTTCCAGTTGAAATAGATGGAACAATACATCAGGTCTATGTGTTAAAACGACCCCACGTAGATGAATTTCTTCAAAAAATGGGCGAGATGTTTGAATGCGTTCTTTTCACAGCCAGCCTTGCGAAGTATGCCGATCCAGTGGCTGATCTGCTAGACGGGTGGGGAGTGTTCAACGCACGACTCTTCCGAGAATCCTGTGTTTTTCACAGGGGAAACTACGTCAAAGATTTAAGCCGCTTAGGTAGAGAACTGAGCAAAGTGATTATAATCGATAACTCTCCTGCGTCATACATCTTCCATCCGGAGAATGCCGTTCCTGTAATGTCTTTGGTTCNACCAACATGCGGGATACCAAAGCTGCTC
Full Trace Sequence: GGGATCTTTTATTTTTACGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACAACACGTCCATCATCACCCAGGTCTCTAACCCCAAGGAGGAGGGAATCCTGTCCTGTGCCCAGGAAAAGGTCTCCCAATGCAATATTAGCCTAAAAAAGCAAAGGAACAGAAGCATCTTCGGCTCCTTATTCTGCTGTTTCCGTAGTTACAGCGTAGAGCCACCAAACTCGAATAATAACAGTAGCCCTCTTCCTCCGCTGGTGGAAGAAAATGGGGGCATTCAGAAGGGTGATCAGACTCAAGCCCTTACCATTCCCAGTCCACCTACTAAATACCTCCTTCCTGAACTGAAAGTATCCGAATATGGGAAGAAGTGCGTGGTCATTGACCTGGATGAAACCTTAGTGCACAGTTCATTTAAGCCTATAAACAACGCAGACTTCATTGTTCCAGTTGAAATAGATGGAACAATACATCAGGTCTATGTGTTAAAACGACCCCACGTAGATGAATTTCTTCAAAAAATGGGCGAGATGTTTGAATGCGTTCTTTTCACAGCCAGCCTTGCGAAGTATGCCGATCCAGTGGCTGATCTGCTAGACGGGTGGGGAGTGTTCAACGCACGACTCTTCCGAGAATCCTGTGTTTTTCACAGGGGAAACTACGTCAAAGATTTAAGCCGCTTAGGTAGAGAACTGAGCAAAGTGATTATAATCGATAACTCTCCTGCGTCATACATCTTCCATCCGGAGAATGCCGTTCCTGTAATGTCTTTGGTTCNACCAACATGCGGGATACCAAAGCTGCTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACAACACGTCCATC

Sequences - 3ʹ (reverse) EST

Accession: JZ838078
dbEST ID: 79655780
Trimmed Sequence: CCTGTTACATAACTTATTTAGCATGTTGTAAACGTTTTCTTCTTTGCTCAGTCCCTCGAAGAAAGGAAGGAGATCGAGCAGCTCTGTATCCGCCATGTCGTCGAACCAAGACATTACAGGAACGGCATTCTCTGGATGGAAGATGTATGACGCAGGAGAGTTATCGATTATAATCACTTTGCTCAGTTCTCTACCTAAGCGGCTTAAATCTTTGACGTAGTTTCCCCTGTGAAAAACACAGGATTCTCGGAAGAGTCGTGCGTTGAACACTCCCCACCGGTCTAGCAGATCAGCCACTGGATCGGCATACTTCGCAAGGCTGGCTGTGAAAAGAACGCATTCAAACATCTCGCCCATTTTTTGAAGAAATTCATCTACGTGGGGTCGTTTTAACACATAGACCTGATGTATTGTTCCATCTATTTCAACTGGAACAATGAAGTCTGCGTTGTTTATAGGCTTAAATGAACTGTGCACTAAGGTTTCATCCAGGTCAATGACCACGCACTTCTTCCCATATTCGGATACTTTCAGTTCAAGAAGGAGGTATTTAGTAAGTGGACTGGGAATGGTAAGGGCTTGAATCTGAACACCCTTCTAAAAGCCCCCTTTTTCTCCCACCCACCGAGAAAAAAGGCTAACGTTAATTATTCCAAATATGGTGGCTCTACGCTTGTAACTACCAAAAAACGCCCGAATAAAGGAAGCCCAAAAAAAACCTTTCCTGTTCCCTTTTTTTTTTTTTTAAGGCC
Full Trace Sequence: GAGGAAAATGCTAGTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCTGTTACATAACTTATTTAGCATGTTGTAAACGTTTTCTTCTTTGCTCAGTCCCTCGAAGAAAGGAAGGAGATCGAGCAGCTCTGTATCCGCCATGTCGTCGAACCAAGACATTACAGGAACGGCATTCTCTGGATGGAAGATGTATGACGCAGGAGAGTTATCGATTATAATCACTTTGCTCAGTTCTCTACCTAAGCGGCTTAAATCTTTGACGTAGTTTCCCCTGTGAAAAACACAGGATTCTCGGAAGAGTCGTGCGTTGAACACTCCCCACCGGTCTAGCAGATCAGCCACTGGATCGGCATACTTCGCAAGGCTGGCTGTGAAAAGAACGCATTCAAACATCTCGCCCATTTTTTGAAGAAATTCATCTACGTGGGGTCGTTTTAACACATAGACCTGATGTATTGTTCCATCTATTTCAACTGGAACAATGAAGTCTGCGTTGTTTATAGGCTTAAATGAACTGTGCACTAAGGTTTCATCCAGGTCAATGACCACGCACTTCTTCCCATATTCGGATACTTTCAGTTCAAGAAGGAGGTATTTAGTAAGTGGACTGGGAATGGTAAGGGCTTGAATCTGAACACCCTTCTAAAAGCCCCCTTTTTCTCCCACCCACCGAGAAAAAAGGCTAACGTTAATTATTCCAAATATGGTGGCTCTACGCTTGTAACTACCAAAAAACGCCCGAATAAAGGAAGCCCAAAAAAAACCTTTCCTGTTCCCTTTTTTTTTTTTTTAAGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTGTTACATAACTTATTTAGCAT