ORFeome > ctdspl2 ORF3 – XORFeome v1.0

ctdspl2 ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ctdspl2
Gene ID: 950107
Gene Page ID: 950100
ORF Xenbase ID: 17271153

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110766
Original XGC clone length: 1401

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ837982
dbEST ID: 79655684
Trimmed Sequence: ATGAGGCTGAGGACGCGGAAGGGGTCTCCGCGCAGCAGTCACGGGGCAGCAGGACGGACTGCTCGTTGCAAGAGGAAGCACTCTGAGGAAGACGAGGAGGAGGAAAGTCCACTTATCGAAGAAGACAAACTGCCTACGCAAGAAACTGGTTTACTATCGACCATCAAAAATTTTATCAAGGGCAGCACAAACAAGGAGGATCGCGAGAACCCTGCAAAGAAGAGCAGAGTAGAACGAGACTTTGATAACAACCTCATCACCTCAACTCCACGAACAGGTGACAAGCCTAGCAAGCCCATTGCACGTGTCCGGAGGAAAAGTCAAGTGAATGGAGAAGCTACAGCTTACGAAGTAAGTCAGCACATGAAGCAAAATGGGAAGCTGGAGGATTTGCCCTGCACCACAAGTCCCCCCAGGACTACCCTACTGGGGACCATTTTTTCTCCAGTCTTCAACTTCTTCTCACCAGCAAATAAAAATGGCACATCCGGATCAGACTCACCGGGGCAAGCGGTGGAAGCCGAGGAGATTGTAAGACAACTGGACATGGAGAAGGTGGATGAATTCAGCACCAACACTGCTACAAATGGAGCTTCTTACCCGAGTCCCGGGTCACCTGTCCGGACTACTGCTAGTATCTGGTTAGAGGGGAATGAAGATACTCCAGAAAAAAAAATTCCACCTCTCCACGCCCCCGTGTCTTCCTGAAACTGGATACTCCTCACCCCATGGCTGAAGCGGGCTATTAAAAAAAAACTTGAGAAGGGTTTGGGTCCGGTGGGTTTGTTTTTAAAACCTTTTTCCAACCCCTTTTTA
Full Trace Sequence: CGCGGGCCACATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGCTGAGGACGCGGAAGGGGTCTCCGCGCAGCAGTCACGGGGCAGCAGGACGGACTGCTCGTTGCAAGAGGAAGCACTCTGAGGAAGACGAGGAGGAGGAAAGTCCACTTATCGAAGAAGACAAACTGCCTACGCAAGAAACTGGTTTACTATCGACCATCAAAAATTTTATCAAGGGCAGCACAAACAAGGAGGATCGCGAGAACCCTGCAAAGAAGAGCAGAGTAGAACGAGACTTTGATAACAACCTCATCACCTCAACTCCACGAACAGGTGACAAGCCTAGCAAGCCCATTGCACGTGTCCGGAGGAAAAGTCAAGTGAATGGAGAAGCTACAGCTTACGAAGTAAGTCAGCACATGAAGCAAAATGGGAAGCTGGAGGATTTGCCCTGCACCACAAGTCCCCCCAGGACTACCCTACTGGGGACCATTTTTTCTCCAGTCTTCAACTTCTTCTCACCAGCAAATAAAAATGGCACATCCGGATCAGACTCACCGGGGCAAGCGGTGGAAGCCGAGGAGATTGTAAGACAACTGGACATGGAGAAGGTGGATGAATTCAGCACCAACACTGCTACAAATGGAGCTTCTTACCCGAGTCCCGGGTCACCTGTCCGGACTACTGCTAGTATCTGGTTAGAGGGGAATGAAGATACTCCAGAAAAAAAAATTCCACCTCTCCACGCCCCCGTGTCTTCCTGAAACTGGATACTCCTCACCCCATGGCTGAAGCGGGCTATTAAAAAAAAACTTGAGAAGGGTTTGGGTCCGGTGGGTTTGTTTTTAAAACCTTTTTCCAACCCCTTTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGCTGAGGACGCGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837981
dbEST ID: 79655683
Trimmed Sequence: GTCTGGGGGTAAGCAGTCGTGCAAGCGAAATCTGTCTCTGATGTGAGGTCGCACATCCTCATTCAGTTCTACCAGCTTCTGCAGGAAAGGGACAAGCTTCAGCAGCTCTTTATCGTTCTTATCCATGAACCAACTCTCAATAGGAATTCCGTTTGAAAGCTGGTATGCAAAGGCTTGTGGTGAATTATCAATGATGATTGTTTTAGAGAGATCCCTTCCAAGGATGTTCAGATCCTTAATGTAGTTTCCTTGGACGCACACACAGTGCTCCCGGAATAGCCTGTGTCTGACCAGCCGTTTTTTGGGATCCAATATATTCAATAATTTGTCTGCATAGACTTTCTTTGATGCTGTAAAAAGTATTATCTCATAAATTTGAGACATACGTTCCAGGAACTCTCGGAAAAAAGGCCTTAACCGGACATACACCTGGTAAATGACATCCTGAAAAAGCACAGGGAACGTTAGTGCAGCATCTTCCAGTTCATTGAGGCTGCAATGCACCAGCGTCTCATCCACGTCAAGGACAAGAGAAAATTCAGGTGTGCTCTTGGTTTTCAGAGGAAAAGCCGGCTTCCTGTTCAACTGCTCCTCAGTCAAAGGTGGGACATGTTTTAATAAAAAAAAATGGAACAAAATACCTCCAAGTCTTCCTCATATGCTTCCTCCGCAATGTGCTGAGGGATAGCACGTTTCAGGAAAACAGGAGGGGGGGAGAAAGGTGGGGAATTCCCGTGCGGGGAGTTACTTTCATTCCCCTTCTAACCCCCCCTATAAACAATA
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTGGGGGTAAGCAGTCGTGCAAGCGAAATCTGTCTCTGATGTGAGGTCGCACATCCTCATTCAGTTCTACCAGCTTCTGCAGGAAAGGGACAAGCTTCAGCAGCTCTTTATCGTTCTTATCCATGAACCAACTCTCAATAGGAATTCCGTTTGAAAGCTGGTATGCAAAGGCTTGTGGTGAATTATCAATGATGATTGTTTTAGAGAGATCCCTTCCAAGGATGTTCAGATCCTTAATGTAGTTTCCTTGGACGCACACACAGTGCTCCCGGAATAGCCTGTGTCTGACCAGCCGTTTTTTGGGATCCAATATATTCAATAATTTGTCTGCATAGACTTTCTTTGATGCTGTAAAAAGTATTATCTCATAAATTTGAGACATACGTTCCAGGAACTCTCGGAAAAAAGGCCTTAACCGGACATACACCTGGTAAATGACATCCTGAAAAAGCACAGGGAACGTTAGTGCAGCATCTTCCAGTTCATTGAGGCTGCAATGCACCAGCGTCTCATCCACGTCAAGGACAAGAGAAAATTCAGGTGTGCTCTTGGTTTTCAGAGGAAAAGCCGGCTTCCTGTTCAACTGCTCCTCAGTCAAAGGTGGGACATGTTTTAATAAAAAAAAATGGAACAAAATACCTCCAAGTCTTCCTCATATGCTTCCTCCGCAATGTGCTGAGGGATAGCACGTTTCAGGAAAACAGGAGGGGGGGAGAAAGGTGGGGAATTCCCGTGCGGGGAGTTACTTTCATTCCCCTTCTAACCCCCCCTATAAACAATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTGGGGGTAAGCAGT