ORFeome > ctnnb1 ORF2 – XORFeome v1.0

ctnnb1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ctnnb1
Gene ID: 6254184
Gene Page ID: 487199
ORF Xenbase ID: 17271189

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082826
Original XGC clone length: 2346

Human orthology & disease relationships

NCBI Entrez ID: 1499
Ensembl gene IDs: ENSG00000168036
Directly associated (OMIM) disease MIM numbers: 114500,114550,132600,167000,615075
Indirectly associated (Lage, et al.) disease MIM numbers: 101000,104300,109800,113800,114480,114500,114550,115150,122880,125853,132600,133100,137215,142946,144200,146590,148700,148820,151623,155255,162091,162210,166600,173900,180849,192430,193500,193520,201475,245590,259500,275355,300068,303600,308370,312300,313200,600274,600652,600962,601214,603278,604326,604370,604416,606889,607602,607654,607785,607822,607841,608089,608615,609015,609048

Library Location

Plate ID: GDExl11047
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ831048
dbEST ID: 79648750
Trimmed Sequence: ATGGCAACTCAAGCAGATCTAATGGAGCTGGACATGGCCATGGAGCCAGACCGAAAGGCAGCAGTGAGCCACTGGCAGCAGCAGTCTTACCTGGATTCTGGGATTCATTCTGGAGCAACCACCACAGCACCATCTTTGAGTGGCAAAGGAAACCCAGAGGATGAAGATGTGGATACCAACCAAGTTTTGTATGAGTGGGAGCAGGGCTTCTCTCAGTCCTTCACTCAAGATCAAGTGGCTGATATTGATGGCCAGTATGCCATGACAAGAGCCCAGCGAGTTCGTGCTGCAATGTTTCCAGAAACCCTTGATGAAGGCATGCAGATTCCATCCACACAATTTGACTCTGCACACCCAACAAATGTGCAACGTTTAGCAGAGCCTTCCCAGATGCTCAAACACGCTGTGGTCAACTTGATCAATTACCAGGATGATGCTGAATTGGCCACTCGAGCAATCCCCGAGCTGACGAAACTGCTTAATGACGAGGACCAGGTTGTAGTTAACAAGGCTGCTGTAATGGTTCACCAGCTGTCAAAGAAGGAAGCCTCACGCCATGCTATAATGCGCTCACCACAGATGGTGTCTGCTATAGTTCGTACAATGCAGAACACAAATGATGTAGAGACTGCACGATGCACTGCGGGAACACTTCAAACCTTTCTCACCCTCGTGAAGGCTTGTTTGCCATATTTAAATCTGGGAGCATTTCCTGCTCCAATTAAAATGGCTTGGCTCAACCAGTTTGAACCCTTGTACAATTTCCATGGCCAATCCCAACACTTGCCAACAAATCCAACTT
Full Trace Sequence: GGGCTTAGCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAACTCAAGCAGATCTAATGGAGCTGGACATGGCCATGGAGCCAGACCGAAAGGCAGCAGTGAGCCACTGGCAGCAGCAGTCTTACCTGGATTCTGGGATTCATTCTGGAGCAACCACCACAGCACCATCTTTGAGTGGCAAAGGAAACCCAGAGGATGAAGATGTGGATACCAACCAAGTTTTGTATGAGTGGGAGCAGGGCTTCTCTCAGTCCTTCACTCAAGATCAAGTGGCTGATATTGATGGCCAGTATGCCATGACAAGAGCCCAGCGAGTTCGTGCTGCAATGTTTCCAGAAACCCTTGATGAAGGCATGCAGATTCCATCCACACAATTTGACTCTGCACACCCAACAAATGTGCAACGTTTAGCAGAGCCTTCCCAGATGCTCAAACACGCTGTGGTCAACTTGATCAATTACCAGGATGATGCTGAATTGGCCACTCGAGCAATCCCCGAGCTGACGAAACTGCTTAATGACGAGGACCAGGTTGTAGTTAACAAGGCTGCTGTAATGGTTCACCAGCTGTCAAAGAAGGAAGCCTCACGCCATGCTATAATGCGCTCACCACAGATGGTGTCTGCTATAGTTCGTACAATGCAGAACACAAATGATGTAGAGACTGCACGATGCACTGCGGGAACACTTCAAACCTTTCTCACCCTCGTGAAGGCTTGTTTGCCATATTTAAATCTGGGAGCATTTCCTGCTCCAATTAAAATGGCTTGGCTCAACCAGTTTGAACCCTTGTACAATTTCCATGGCCAATCCCAACACTTGCCAACAAATCCAACTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACTCAAGCAGATCTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ831049
dbEST ID: 79648751
Trimmed Sequence: CAAGTCAGTGTCAAACCAGGCCAGTTGGTTGCTATCACCTGGAGGTAGTCCATCCATAAGATCTTGGGCATGACTCAAGTCAGGAAGTCCATCAACTGGATAGTCTGCCCCTGGGTGGTGACCTCCCATGTCATGATCCATCATGGAGTCCATACCCATTGCATCCTGACCATAGCCAGCAGCATGGAAAGATCGGTAGCTTGAATCATCCTGTCTGTAGCCAAGAGGTTCGCCTTGGGCACCAATATCAAGACCAAGGTCTGCAGCCTCATTCCATGGCATTGGCTCGGTCCTGAAGAGAGAGCTGGTCAACTCAACTGACAGACGCTTCTTGTAGTCCTGGGGTTTGTCCTCAGACATACGGAACAGAACAGCAGCTGCATAAGTTGCGACACCTTCATTTCTAGAGTGAAGCAGCTCAGTAAGAGGAGCAGTTGCACCTTCAGCTTCAATAGCTTCAGCAGCCTCTTTGTCTTGCGCCAGCTCACACAGCACACCTGCTGCCACTCTTTGGATATTTTCAATAGGCGAATACAGCAACTGCACAATAAATGGAATGGTGTTAAAGACTCTGATAACAATTCGGGTTGTGGATGTCACGAAGCAAAATGTGAAGAGCACCCTGTGCAGCCTTCAACAATCCTCCTCCATGGCGACACCCTCCCCAAAATGCTTGTTTGGTCCCCACCCATTGAAGTGGCCCCCTTCTGTTTCCCCGGGGTGGCCCCCAACAAACAAACTAAAAAAAAACCCGGGGAAAAGGGACCCCCTTT
Full Trace Sequence: TGACGGGCAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAGTCAGTGTCAAACCAGGCCAGTTGGTTGCTATCACCTGGAGGTAGTCCATCCATAAGATCTTGGGCATGACTCAAGTCAGGAAGTCCATCAACTGGATAGTCTGCCCCTGGGTGGTGACCTCCCATGTCATGATCCATCATGGAGTCCATACCCATTGCATCCTGACCATAGCCAGCAGCATGGAAAGATCGGTAGCTTGAATCATCCTGTCTGTAGCCAAGAGGTTCGCCTTGGGCACCAATATCAAGACCAAGGTCTGCAGCCTCATTCCATGGCATTGGCTCGGTCCTGAAGAGAGAGCTGGTCAACTCAACTGACAGACGCTTCTTGTAGTCCTGGGGTTTGTCCTCAGACATACGGAACAGAACAGCAGCTGCATAAGTTGCGACACCTTCATTTCTAGAGTGAAGCAGCTCAGTAAGAGGAGCAGTTGCACCTTCAGCTTCAATAGCTTCAGCAGCCTCTTTGTCTTGCGCCAGCTCACACAGCACACCTGCTGCCACTCTTTGGATATTTTCAATAGGCGAATACAGCAACTGCACAATAAATGGAATGGTGTTAAAGACTCTGATAACAATTCGGGTTGTGGATGTCACGAAGCAAAATGTGAAGAGCACCCTGTGCAGCCTTCAACAATCCTCCTCCATGGCGACACCCTCCCCAAAATGCTTGTTTGGTCCCCACCCATTGAAGTGGCCCCCTTCTGTTTCCCCGGGGTGGCCCCCAACAAACAAACTAAAAAAAAACCCGGGGAAAAGGGACCCCCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAGTCAGTGTCAAACCAG