ORFeome > ctps1 ORF1 – XORFeome v1.0

ctps1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ctps1
Gene ID: 957436
Gene Page ID: 957431
ORF Xenbase ID: 17271225

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044325
Original XGC clone length: 1776

Human orthology & disease relationships

NCBI Entrez ID: 1503
Ensembl gene IDs: ENSG00000171793
Directly associated (OMIM) disease MIM numbers: 615897
Indirectly associated (Lage, et al.) disease MIM numbers: 223100,307030,603903

Library Location

Plate ID: GDExl11009
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ823705
dbEST ID: 79641407
Trimmed Sequence: ATGAAGTATATACTGGTTACAGGTGGAGTCATCTCTGGCATTGGCAAAGGGGTCATTGCCAGTAGTGTTGGGACCATTTTGAAATCAAGCAACCTGCATGTGACTTCAATCAAAATTGACCCCTACATCAATATTGATGCAGGGACCTTCTCCCCGTATGAACATGGGGAAGTATTTGTGCTGGATGATGGAGGTGAAGTGGATCTCGACCTTGGCAATTATGAACGTTTTCTAGACATTCGGTTAACAAAAGATAATAATTTAACAACTGGAAAAATCTACCAGTCTGTTATTAACAAGGAGAGAAAAGGCGATTACCTTGGAAAAACAGTTCAAGTTGTTCCTCACATCACAGAGGCAATCCAAGAGTGGGTAATGAGACAAGCGCTTATTCCAGTGGATGAAGATGGTATAGAACCGGAAGTCTGCGTGATAGAGCTTGGGGGCACTGTAGGAGATATAGAGAGCATGCCCTTTGTGGAAGCATTTCGTCAGTTCCAGTTCAAAGCTCGCAGAGAAAATTTTTGCAATATTCATGTCAGCCTTGTACCACAGCCTAGTGCTACTGGGGAGCAGAAAACCAAACCTACACAGAACAGCGTGCGGGAACTCCGTGGACTAGGCCTATCGCCAGACCTGGTGGTGTGTAGGTGTTCCACTCCACTAGACACTTCTGTTAAGGAGAAATATCCATGTTCTGTCATGTAGAGCCGCAGCAGGTTATCTGTGTTCATGATGTCTCCTCAATATATAGAGTACCTCTTCTG
Full Trace Sequence: ACAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGTATATACTGGTTACAGGTGGAGTCATCTCTGGCATTGGCAAAGGGGTCATTGCCAGTAGTGTTGGGACCATTTTGAAATCAAGCAACCTGCATGTGACTTCAATCAAAATTGACCCCTACATCAATATTGATGCAGGGACCTTCTCCCCGTATGAACATGGGGAAGTATTTGTGCTGGATGATGGAGGTGAAGTGGATCTCGACCTTGGCAATTATGAACGTTTTCTAGACATTCGGTTAACAAAAGATAATAATTTAACAACTGGAAAAATCTACCAGTCTGTTATTAACAAGGAGAGAAAAGGCGATTACCTTGGAAAAACAGTTCAAGTTGTTCCTCACATCACAGAGGCAATCCAAGAGTGGGTAATGAGACAAGCGCTTATTCCAGTGGATGAAGATGGTATAGAACCGGAAGTCTGCGTGATAGAGCTTGGGGGCACTGTAGGAGATATAGAGAGCATGCCCTTTGTGGAAGCATTTCGTCAGTTCCAGTTCAAAGCTCGCAGAGAAAATTTTTGCAATATTCATGTCAGCCTTGTACCACAGCCTAGTGCTACTGGGGAGCAGAAAACCAAACCTACACAGAACAGCGTGCGGGAACTCCGTGGACTAGGCCTATCGCCAGACCTGGTGGTGTGTAGGTGTTCCACTCCACTAGACACTTCTGTTAAGGAGAAATATCCATGTTCTGTCATGTAGAGCCGCAGCAGGTTATCTGTGTTCATGATGTCTCCTCAATATATAGAGTACCTCTTCTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGTATATACTGGTTACAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829015
dbEST ID: 79646717
Trimmed Sequence: TTCGTGATCAATCATCGGTAACTTGAGCTCTGCTATTTCTGCATCAGGAGAACTGTTCTCACTTCTGTCGCTGTAGGTGTCCCTAGGTGAAAGCCGGCATCCTCTTTCTATATACTGAGAAAGTCTTCCCACAGAAGCCAGTAACAAGCCAAAATATGGGGGTGAGGGCTTGATGGGACGGGACAGAAATTCGGGATGATACTGAACACCAACAAAATAAGGATGATCCTCCAATTCAACAATTTCCATCCTTTCTCCTTCTGTGTCCTGACCCACAAACTTTAAGCCTCGAGCTTCCAGTTCTCTTCGAAGTTCTGGGTTCACCTCATATCTGTGGCGGTGTCTCTCTTCCACATACTCATGGCCTCCATATAATTTCTTCATGACTGAATTCTGGGAATGAAAGATGGTTCTTCTTTTGCCTAACCTCATGGTTCCACCCATCTGACCAGGGTTATGTTCAGGCATGTCAATTACCACTGGATGACTTGTTTTAGGGTTGAATTCTGTGGAATTCGCATCTTTCCAGTCCAGGACATCACGTGCAAATTCAACAACGGCTAACTGCATTCCTAAACACACCCCCAAAAAAGGCTTCTTCTGTTTTCGCGCCCAGGCTATTGCCTGAAATCTTCCTTTCTGTCCTCGTACCCCAAATCCTCCCAGTACCAAGATGCCATCTGAACTTGCAAGCTTCTTGCAAGCCTTCAGGGTAACCCAAAGGCTCTTTCCGTAAA
Full Trace Sequence: TGGCGGGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCGTGATCAATCATCGGTAACTTGAGCTCTGCTATTTCTGCATCAGGAGAACTGTTCTCACTTCTGTCGCTGTAGGTGTCCCTAGGTGAAAGCCGGCATCCTCTTTCTATATACTGAGAAAGTCTTCCCACAGAAGCCAGTAACAAGCCAAAATATGGGGGTGAGGGCTTGATGGGACGGGACAGAAATTCGGGATGATACTGAACACCAACAAAATAAGGATGATCCTCCAATTCAACAATTTCCATCCTTTCTCCTTCTGTGTCCTGACCCACAAACTTTAAGCCTCGAGCTTCCAGTTCTCTTCGAAGTTCTGGGTTCACCTCATATCTGTGGCGGTGTCTCTCTTCCACATACTCATGGCCTCCATATAATTTCTTCATGACTGAATTCTGGGAATGAAAGATGGTTCTTCTTTTGCCTAACCTCATGGTTCCACCCATCTGACCAGGGTTATGTTCAGGCATGTCAATTACCACTGGATGACTTGTTTTAGGGTTGAATTCTGTGGAATTCGCATCTTTCCAGTCCAGGACATCACGTGCAAATTCAACAACGGCTAACTGCATTCCTAAACACACCCCCAAAAAAGGCTTCTTCTGTTTTCGCGCCCAGGCTATTGCCTGAAATCTTCCTTTCTGTCCTCGTACCCCAAATCCTCCCAGTACCAAGATGCCATCTGAACTTGCAAGCTTCTTGCAAGCCTTCAGGGTAACCCAAAGGCTCTTTCCGTAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCGTGATCAATCATCGGTAACT