ORFeome > ctrb1 ORF1 – XORFeome v1.0

ctrb1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ctrb1
Gene ID: 977512
Gene Page ID: 977508
ORF Xenbase ID: 17271243

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056849
Original XGC clone length: 792

Human orthology & disease relationships

NCBI Entrez ID: 1504
Ensembl gene IDs: ENSG00000168925
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,603813,609065

Library Location

Plate ID: GDExl11002
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ839281
dbEST ID: 79656983
Trimmed Sequence: ATGGCTTTCCTTTGGCTTGTATCCTGCCTGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAACCAGCAGGTGCGCAACAAAAAATTCCAGGTGGTGTACGCCCCGTGTCCCAATTTCCCCCCTTTCTTGGGGTTTTAACAAAAATTTGTTTTCCCCTCCAA
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTTCCTTTGGCTTGTATCCTGCCTGGCTTTAGCCACCACAGTTTATGGCTGTGGCCAACCTGAAATCGCTCCAGTGGTGACTGGCTATGCCAGGATTGTGAATGGTGAGGAAGCAGTTCCAGGTTCTTGGCCTTGGCAAGTCTCCCTACAGGATTCCACTGGATGGCACTATTGTGGTGGTTCCCTTATTAACAATGAGTGGGTTGTAACTGCAGCTCACTGTGGTGTTGGGGCCAGAGATAAAGTGGTTCTTGGAGAGCATGACCGCAGTTCAAACGTTGAAAAAATCCAGTCTCTTGCTGTTGCTAAGGTCTTCACACACCCACAGTGGAATTCCAACACAATCAACAATGATATTTCCCTAATTAAGTTGGCCACTCCAGCTGTCTTTAGCTCAGCTGTGTCTCCAGTTTGTCTGGCTAATATTGGAGAAGATTATGTTGGAGGACGCATCTGTGTTACCAGTGGATGGGGAAAGACCAGATACAACGCATTTACAACTCCAAACCTACTTCAACAAACTGCTCTGCCTCTGCTGACAAACGATCAGTGCAAGAGCTACTGGGGAAATAATATCCTTGGCTCAATGATCTGCGCTGGTGCTGCTGGCTCCTCCTCCTGCATGGGTGATTCTGGTGGACCACTTGTATGCCAGGACAATGGTGCATGGTCACTTGTTGGCATTGTGTCCTGGGGAAACCAGCAGGTGCGCAACAAAAAATTCCAGGTGGTGTACGCCCCGTGTCCCAATTTCCCCCCTTTCTTGGGGTTTTAACAAAAATTTGTTTTCCCCTCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTCCTTTGGCTTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839280
dbEST ID: 79656982
Trimmed Sequence: GTTGGAGGCAACAATCTCGTCAACCCAAGAACGGAGAACTGTGACACGGGCGTACACACCTGGACTGTTTGTTGCGCACATGCTGCTTCCCCAGGACACAATGCCAACAAGTGACCATGCACCATTGTCCTGGCATACAAGTGGTCCACCAGAATCACCCATGCAGGAGGAGGAGCCAGCAGCACCAGCGCAGATCATTGAGCCAAGGATATTATTTCCCCAGTAGCTCTTGCACTGATCGTTTGTCAGCAGAGGCAGAGCAGTTTGTTGAAGTAGGTTTGGAGTTGTAAATGCGTTGTATCTGGTCTTTCCCCATCCACTGGTAACACAGATGCGTCCTCCAACATAATCTTCTCCAATATTAGCCAGACAAACTGGAGACACAGCTGAGCTAAAGACAGCTGGAGTGGCCAACTTAATTAGGGAAATATCATTGTTGATTGTGTTGGAATTCCACTGTGGGTGTGTGAAGACCTTAGCAACAGCAAGAGACTGGATTTTTTCAACGTTTGAACTGCGGTCATGCTCTCCAAGAACCACTTTATCTCTGGCCCCAACACCACAGTAAGCTGCAGTTACAACCCACTCATTGGTTAATAAGGAACCACCACAATAGTGGCCATCCGTGGAATCCTGTAAGGGAAAACTTGCCAAGGCCCAGAACCCGGAAACTTGCTTCCCTCCACCATTTACAAATCCCTGGCATAACCCCGGTCCACCCACGGGAAACCCAATTTTCACGGTTTGGCCCCACAGCCCCAAAAA
Full Trace Sequence: GGGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGGAGGCAACAATCTCGTCAACCCAAGAACGGAGAACTGTGACACGGGCGTACACACCTGGACTGTTTGTTGCGCACATGCTGCTTCCCCAGGACACAATGCCAACAAGTGACCATGCACCATTGTCCTGGCATACAAGTGGTCCACCAGAATCACCCATGCAGGAGGAGGAGCCAGCAGCACCAGCGCAGATCATTGAGCCAAGGATATTATTTCCCCAGTAGCTCTTGCACTGATCGTTTGTCAGCAGAGGCAGAGCAGTTTGTTGAAGTAGGTTTGGAGTTGTAAATGCGTTGTATCTGGTCTTTCCCCATCCACTGGTAACACAGATGCGTCCTCCAACATAATCTTCTCCAATATTAGCCAGACAAACTGGAGACACAGCTGAGCTAAAGACAGCTGGAGTGGCCAACTTAATTAGGGAAATATCATTGTTGATTGTGTTGGAATTCCACTGTGGGTGTGTGAAGACCTTAGCAACAGCAAGAGACTGGATTTTTTCAACGTTTGAACTGCGGTCATGCTCTCCAAGAACCACTTTATCTCTGGCCCCAACACCACAGTAAGCTGCAGTTACAACCCACTCATTGGTTAATAAGGAACCACCACAATAGTGGCCATCCGTGGAATCCTGTAAGGGAAAACTTGCCAAGGCCCAGAACCCGGAAACTTGCTTCCCTCCACCATTTACAAATCCCTGGCATAACCCCGGTCCACCCACGGGAAACCCAATTTTCACGGTTTGGCCCCACAGCCCCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGGAGGCAACAATCTCGT