ORFeome > ctrl ORF1 – XORFeome v1.0

ctrl ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ctrl
Gene ID: 5876509
Gene Page ID: 5876073
ORF Xenbase ID: 17271261

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054286
Original XGC clone length: 792

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ839347
dbEST ID: 79657049
Trimmed Sequence: ATGGCACTTCTCTGGCTTTTGTCCTGCATTGCCCTTATTGGGAGCACGTATGGCTGTGGTAGCCCAGCCATCAATCCAATACTTTCTGGATATGCTAGGATTGTGAATGGTGAAAATGCAGTACCTGGATCCTGGCCTTGGCAAATTTCTCTGCAGGACAGCACTGGTTTCCACTTCTGTGGTGGCTCTTTGATTAGCGACCTCTGGGTTGTCACTGCTGCACATTGCGGTGTCACAACCTCCCACCGTGTTATTCTTGGTGAATATGATCGTTCTTCTCCAGCTGAGCCTATCCAGACCAAAACAATTGCCAAGGTTTTCAGACACCCCAGTTACAACTCGTTCACCATTGCCAATGATATCACACTTCTGAAACTGTCCAGCCCTGCTTCCTTCAGCAACACTGTTTCTACTGTCTGCGTTGCTGCTTCCGTAGATGCGTTCAATAGTGGCGAGAGATGCGTCACAACTGGCTGGGGCTACGTGGATGCTGCCTCTAGATTAACCCCAAACAAGCTGCAGCAGGTAGCTCTGCCTCTTCTAAGCAACACTGAATGCCGGAGATATTGGGGAAACAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCTTGCATGGGTGACTCTGGTGGAACACTTGTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGAATTGTTTCCTGGGGAAATTTCTCAGGCTCTCCATCACCCCCCGGAATAAATTGCTCGTGTCCCAACCCCTAAAAATCCCGGAAGGAATCAAAAAAATTTGCTCCCCATTTTTCCCCAACCTTTC
Full Trace Sequence: TCGAGGGCCAAATAATAGATTTTANTTTTGACTGATAGTGACCTGNTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACTTCTCTGGCTTTTGTCCTGCATTGCCCTTATTGGGAGCACGTATGGCTGTGGTAGCCCAGCCATCAATCCAATACTTTCTGGATATGCTAGGATTGTGAATGGTGAAAATGCAGTACCTGGATCCTGGCCTTGGCAAATTTCTCTGCAGGACAGCACTGGTTTCCACTTCTGTGGTGGCTCTTTGATTAGCGACCTCTGGGTTGTCACTGCTGCACATTGCGGTGTCACAACCTCCCACCGTGTTATTCTTGGTGAATATGATCGTTCTTCTCCAGCTGAGCCTATCCAGACCAAAACAATTGCCAAGGTTTTCAGACACCCCAGTTACAACTCGTTCACCATTGCCAATGATATCACACTTCTGAAACTGTCCAGCCCTGCTTCCTTCAGCAACACTGTTTCTACTGTCTGCGTTGCTGCTTCCGTAGATGCGTTCAATAGTGGCGAGAGATGCGTCACAACTGGCTGGGGCTACGTGGATGCTGCCTCTAGATTAACCCCAAACAAGCTGCAGCAGGTAGCTCTGCCTCTTCTAAGCAACACTGAATGCCGGAGATATTGGGGAAACAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCTTGCATGGGTGACTCTGGTGGAACACTTGTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGAATTGTTTCCTGGGGAAATTTCTCAGGCTCTCCATCACCCCCCGGAATAAATTGCTCGTGTCCCAACCCCTAAAAATCCCGGAAGGAATCAAAAAAATTTGCTCCCCATTTTTCCCCAACCTTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACTTCTCTGGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839346
dbEST ID: 79657048
Trimmed Sequence: ATTGGCAGCAATTATCTGATCCATCCAGGATCTAAGAGTTGAGACACGAGCATATACTCCAGGAGATGATGGAGAGCATGTAGAACTTCCCCAGGACACAATTCCAGCCAGCACCCAAGCTCCATTTCTTTGGCACACAAGTGGTCCACCAGAGTCACCCATGCAAGAAGAGGCACCAGAAGCACCAGCACAGACCATTGTGCTTAGGATCTTGCTTCCCCAATATCTCCGGCATTCAGTGTTGCTTAGAAGAGGCAGAGCTACCTGCTGCAGCTTGTTTGGGGTTAATCTAGAGGCAGCATCCACGTAGCCCCAGCCAGTTGTGACGCATCTCTCGCCACTATTGAACGCATCTACGGAAGCAGCAACGCAGACAGTAGAAACAGTGTTGCTGAAGGAAGCAGGGCTGGACAGTTTCAGAAGTGTGATATCATTGGCAATGGTGAACGAGTTGTAACTGGGGTGTCTGAAAACCTTGGCAATTGTTTTGGTCTGGATAGGCTCAGCTGGAGAAGAACGATCATATTCACCAAGAATAACACGGTGGGGAGGTTGTGACACCGCAATGTGCAGCAGTGACAACCCCGAGGTCGCTAATTCAAGAGCCCCCCCCGAAGTGGAAAACCGTGCTGTCCTGCAAAGAAATTTTGCAAGGCCAGGAACCCGGGTACTGCATTTTTCACCAATTCAAAATCCCTAACCAAATCCCAAAAAGGTATTGGGAAAATGAAGTGGCGGGGGGGCCAAACCAA
Full Trace Sequence: GGAGAAAACGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTGGCAGCAATTATCTGATCCATCCAGGATCTAAGAGTTGAGACACGAGCATATACTCCAGGAGATGATGGAGAGCATGTAGAACTTCCCCAGGACACAATTCCAGCCAGCACCCAAGCTCCATTTCTTTGGCACACAAGTGGTCCACCAGAGTCACCCATGCAAGAAGAGGCACCAGAAGCACCAGCACAGACCATTGTGCTTAGGATCTTGCTTCCCCAATATCTCCGGCATTCAGTGTTGCTTAGAAGAGGCAGAGCTACCTGCTGCAGCTTGTTTGGGGTTAATCTAGAGGCAGCATCCACGTAGCCCCAGCCAGTTGTGACGCATCTCTCGCCACTATTGAACGCATCTACGGAAGCAGCAACGCAGACAGTAGAAACAGTGTTGCTGAAGGAAGCAGGGCTGGACAGTTTCAGAAGTGTGATATCATTGGCAATGGTGAACGAGTTGTAACTGGGGTGTCTGAAAACCTTGGCAATTGTTTTGGTCTGGATAGGCTCAGCTGGAGAAGAACGATCATATTCACCAAGAATAACACGGTGGGGAGGTTGTGACACCGCAATGTGCAGCAGTGACAACCCCGAGGTCGCTAATTCAAGAGCCCCCCCCGAAGTGGAAAACCGTGCTGTCCTGCAAAGAAATTTTGCAAGGCCAGGAACCCGGGTACTGCATTTTTCACCAATTCAAAATCCCTAACCAAATCCCAAAAAGGTATTGGGAAAATGAAGTGGCGGGGGGGCCAAACCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGGCAGCAATTATCTGATCCAT