ORFeome > ctsh ORF1 – XORFeome v1.0

ctsh ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ctsh
Gene ID: 5820439
Gene Page ID: 5820391
ORF Xenbase ID: 17271285

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC129703
Original XGC clone length: 960

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ838616
dbEST ID: 79656318
Trimmed Sequence: ATGGTGAGTGCTTCGGCCTCACATTTACTTGATGATGAGTGGAACGTGTGGAAGTCTAAATATGAGAAGAAATATGCCGGCTTGGAAGATGAGTTATTTCGAAGGAAAGTCTGGGAGGTCAACTGGGATAAGGTCACAAAGCACAATCAATTGGCTGACCAAGGACTCAAAAAATATACGATGGCAATGAATCACTTTGCTGATATGACCATAGAAGAAATTAATTCAAGGAACTGCCTTTTGACTACAAATTATCATTCAATGCCCAAATCTATTCCCAAGTACAATGTGAAAAATGCTAAAATGACTAAAGCAGTTGACTGGAGGGATTCTAACTGTGTCAGTCCAGTTAAAGATCAAGGATATTGTGGATCCTGTTGGGCATTTGCAACGGTTGGTGTTATTGAAGCACTTCATTGCCTTGCGGGTAACGAACTTTCTAATTTGAGCGAGCAGCAACTTGTGGACTGTGATCACTTAGATAGCGGATGCTGTGGGGGGTTTCCACTACTTGCTATGGATTACATTGCACACCGTGGAATCATGAAGACTGAGGACTATGAGTATGAAGCAAAGCAATCTAACTGCCAATATGATTCCGACAATGCCATACGACCGAGTGTTTCCAAGTACTAGCTTTTGCCTTGAAGAAAAAAACATGGCCATCTTTTGGTTCTAGGGATGGGACAAGTAATGGTTGGGGTTTGCGTGGGGCTTGAAGAATTTTTGTTTCTTACATAAAAAGGGAAATGTTTGATGGGGGAATAGGTGCACCAGGGC
Full Trace Sequence: TCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGAGTGCTTCGGCCTCACATTTACTTGATGATGAGTGGAACGTGTGGAAGTCTAAATATGAGAAGAAATATGCCGGCTTGGAAGATGAGTTATTTCGAAGGAAAGTCTGGGAGGTCAACTGGGATAAGGTCACAAAGCACAATCAATTGGCTGACCAAGGACTCAAAAAATATACGATGGCAATGAATCACTTTGCTGATATGACCATAGAAGAAATTAATTCAAGGAACTGCCTTTTGACTACAAATTATCATTCAATGCCCAAATCTATTCCCAAGTACAATGTGAAAAATGCTAAAATGACTAAAGCAGTTGACTGGAGGGATTCTAACTGTGTCAGTCCAGTTAAAGATCAAGGATATTGTGGATCCTGTTGGGCATTTGCAACGGTTGGTGTTATTGAAGCACTTCATTGCCTTGCGGGTAACGAACTTTCTAATTTGAGCGAGCAGCAACTTGTGGACTGTGATCACTTAGATAGCGGATGCTGTGGGGGGTTTCCACTACTTGCTATGGATTACATTGCACACCGTGGAATCATGAAGACTGAGGACTATGAGTATGAAGCAAAGCAATCTAACTGCCAATATGATTCCGACAATGCCATACGACCGAGTGTTTCCAAGTACTAGCTTTTGCCTTGAAGAAAAAAACATGGCCATCTTTTGGTTCTAGGGATGGGACAAGTAATGGTTGGGGTTTGCGTGGGGCTTGAAGAATTTTTGTTTCTTACATAAAAAGGGAAATGTTTGATGGGGGAATAGGTGCACCAGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAGTGCTTCGGC

Sequences - 3ʹ (reverse) EST

Accession: JZ838615
dbEST ID: 79656317
Trimmed Sequence: TGCTTTCAACTCCATAGAAGCTGCAAATTCTGAAATGCCACACATGTCTTTGTTGCGCTGTATTTTTCCAAATCCTTCTTCTCCCCAATGCTCGCCCCAGCTATTTTTTATTATCCAGTAGTCCTCACCATCATCTTCTCCATCCTCACAATGCAAGGTGCCATAGCCCACAACAATTATTGCATGATTTGGGCTTGGTGCACATTCCCCATCAAATATTCCTTTACTGTAGAACATAAAGTCTTCAGCCACAGCAAACCCAACAGTAATTGGTCCATCCTTAGCAACAGAAGATGCCATGTTTTCTTCATCAGGCAAAATGTAGTACTTGGAAACATTCAGTCGTATTGCATTGTCGGAATCATATTGGCAGGTAGATTGCTTTGCTTCATACTCATAGTCCTCAGTCTTCATGATTCCACGGTGTGCAATGTAATCCATAGCAAGTACTGGAAACCCCCCACAGCATCCGCTATCTAAGTGATCACAGTCCACAAGTTGCTGCTCGCTCAAATTAGAAAGTTCGTTACCCGCAGGGCAATGAAGTGCTTCAATAACACCAACCGTTGCAAATGCCCAACAGGATCCACAATATCCTTGATCTTTAACTGGACTGACACAGTTAGAATCCCCTCGGTTCACTGCTTTAGTTCATTTACCATTTTTCAAATTGTAATTGGGAAATAAATTTGGGCATTGAAGGGATAATTTGTATTTCAAAAGGGGATTTCCCTTTGAATTAATTTTTTTCCTTAGGGGTCATTAATAAC
Full Trace Sequence: GGGAAACGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCTTTCAACTCCATAGAAGCTGCAAATTCTGAAATGCCACACATGTCTTTGTTGCGCTGTATTTTTCCAAATCCTTCTTCTCCCCAATGCTCGCCCCAGCTATTTTTTATTATCCAGTAGTCCTCACCATCATCTTCTCCATCCTCACAATGCAAGGTGCCATAGCCCACAACAATTATTGCATGATTTGGGCTTGGTGCACATTCCCCATCAAATATTCCTTTACTGTAGAACATAAAGTCTTCAGCCACAGCAAACCCAACAGTAATTGGTCCATCCTTAGCAACAGAAGATGCCATGTTTTCTTCATCAGGCAAAATGTAGTACTTGGAAACATTCAGTCGTATTGCATTGTCGGAATCATATTGGCAGGTAGATTGCTTTGCTTCATACTCATAGTCCTCAGTCTTCATGATTCCACGGTGTGCAATGTAATCCATAGCAAGTACTGGAAACCCCCCACAGCATCCGCTATCTAAGTGATCACAGTCCACAAGTTGCTGCTCGCTCAAATTAGAAAGTTCGTTACCCGCAGGGCAATGAAGTGCTTCAATAACACCAACCGTTGCAAATGCCCAACAGGATCCACAATATCCTTGATCTTTAACTGGACTGACACAGTTAGAATCCCCTCGGTTCACTGCTTTAGTTCATTTACCATTTTTCAAATTGTAATTGGGAAATAAATTTGGGCATTGAAGGGATAATTTGTATTTCAAAAGGGGATTTCCCTTTGAATTAATTTTTTTCCTTAGGGGTCATTAATAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTTTCAACTCCATAGAAGCTG