ORFeome > ctsz ORF1 – XORFeome v1.0

ctsz ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ctsz
Gene ID: 959213
Gene Page ID: 959210
ORF Xenbase ID: 17271309

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082931
Original XGC clone length: 891

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ839858
dbEST ID: 79657560
Trimmed Sequence: ATGGCCAGGCTGTTATTGCTGCTCTTTTCCCTTATCTCCTGGGTCAGTGGGGGGCTCTACTTCCAGCAGGGGCAGCACTGTTACAAGCCCCCACTCAAAAGGCACCCAGGAATCAGGAACTACCAGCGGCCGCACGAATACATCTCGGTGTCGGACCTGCCAAAAGCCTGGGACTGGCGCAATGTGAATGGAACAAACTATGTCAGCACCACCCGCAACCAGCACATCCCCCAGTATTGTGGCTCCTGCTGGGCTCATGGGAGCACTAGTGCCATGGCAGACAGGATTAATATCAAGCGCAATGGGGTGTGGCCCTCGGCTTACCTATCTGTTCAGCACGTCATTGATTGCGCCAATGCAGGGTCCTGCGAGGGAGGAGACCACGGAGGTGTCTGGGAGTACGCAAACAGTCACGGGATTCCTGACGAGACCTGCAACAACTACCAAGCCAAAGACCAAAAATGCGACACGTTTAACCAGTGCGGCACGTGTGTGACCTTCGGGAAGTGCTTCAACATCTCCAATTACACTCTGTGGAAGGTGGGAGACTTTGGGTCAGTCAACGGGAGAGAAAAAATAATGGCGGAAATCTACAAAAATGGACCAATCAACTGTGGGATAATGGCCACACAAAAACTAAAGGCCAACACAAGGGGTCTCCTATGCGAATTTTCACCCAAACCCAATAATCAATCAAATTTTCCTCCCTGGCTGGGAATGGGGAATTGGAAAAAAAAACGGAAATGAAATACTGGAAATTTGCCCAAAAAATTCTTGGGGGGGAAACCCTTTGGGGGAAAAAAAAAGGGGGGCG
Full Trace Sequence: CGTGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAGGCTGTTATTGCTGCTCTTTTCCCTTATCTCCTGGGTCAGTGGGGGGCTCTACTTCCAGCAGGGGCAGCACTGTTACAAGCCCCCACTCAAAAGGCACCCAGGAATCAGGAACTACCAGCGGCCGCACGAATACATCTCGGTGTCGGACCTGCCAAAAGCCTGGGACTGGCGCAATGTGAATGGAACAAACTATGTCAGCACCACCCGCAACCAGCACATCCCCCAGTATTGTGGCTCCTGCTGGGCTCATGGGAGCACTAGTGCCATGGCAGACAGGATTAATATCAAGCGCAATGGGGTGTGGCCCTCGGCTTACCTATCTGTTCAGCACGTCATTGATTGCGCCAATGCAGGGTCCTGCGAGGGAGGAGACCACGGAGGTGTCTGGGAGTACGCAAACAGTCACGGGATTCCTGACGAGACCTGCAACAACTACCAAGCCAAAGACCAAAAATGCGACACGTTTAACCAGTGCGGCACGTGTGTGACCTTCGGGAAGTGCTTCAACATCTCCAATTACACTCTGTGGAAGGTGGGAGACTTTGGGTCAGTCAACGGGAGAGAAAAAATAATGGCGGAAATCTACAAAAATGGACCAATCAACTGTGGGATAATGGCCACACAAAAACTAAAGGCCAACACAAGGGGTCTCCTATGCGAATTTTCACCCAAACCCAATAATCAATCAAATTTTCCTCCCTGGCTGGGAATGGGGAATTGGAAAAAAAAACGGAAATGAAATACTGGAAATTTGCCCAAAAAATTCTTGGGGGGGAAACCCTTTGGGGGAAAAAAAAAGGGGGGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAGGCTGTTATTGCTGCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ839857
dbEST ID: 79657559
Trimmed Sequence: TGGGAGAATGGGGTCACCGTATGCACAGTCCTCTTCAATAGCCAGGTTGTAGTCGGCCCCCTTGCCTCCCTTGTACGCACTGGTGACTATGCGCAGCCAGCCCCTCTCTCCCCAGGGCTCCCCCCACGAATTTCGCACAATCCAGTATTCCACTCCGTTCTCATCCAATCCCCATCCAGCCACGGAGACAATGTGATTGATCATTGCGCTAGGCTGAAACTCCGCATAGAGACCCCCTGTGTAGGCATCTAGTTTCTCTGTGGCCATTATCCCACAGCTGATTGGTCCATTTTTGTAGATTTCCGCCATCATCTTTTCTCTCCCGCTGACTGACCCAAAGTCTCCCACCTTCCACAGAGTGTAATTGGAGATGTTGAAGCACTTCCCGAAGGTCACACACGTGCCGCACTGGTTAAACGTGTCGCATTTTTGGTCTTTGGCTTGGTAGTTGTTGCAGGTCTCGTCAGGAATCCCGTGACTGTTTGCGTACTCCCAGACACCTCCNTGGTCTCCTCCCTCGCANGACCCTGCATTGGCGCAATCAATGACGTGCTGAACAGATAGGTAAGCCGAGGGCCACACCCCATTGCGCTTGATATTAATCCTGTCTGCCATGGCACTAATGCTCCCATGAGCCCAACAAGAGCCACATACCTGGGGGATGTGCTGGTTGCGGGTGGGGCTTAACTAGTTTTTTTCATTCCCATTTGCGCCCGTCCAAGGCCTTTTGGCAGGTCCAAAACCCAAAAATGATTCTCGTGCGGCCCGCCTGGAAATTTC
Full Trace Sequence: GAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGGAGAATGGGGTCACCGTATGCACAGTCCTCTTCAATAGCCAGGTTGTAGTCGGCCCCCTTGCCTCCCTTGTACGCACTGGTGACTATGCGCAGCCAGCCCCTCTCTCCCCAGGGCTCCCCCCACGAATTTCGCACAATCCAGTATTCCACTCCGTTCTCATCCAATCCCCATCCAGCCACGGAGACAATGTGATTGATCATTGCGCTAGGCTGAAACTCCGCATAGAGACCCCCTGTGTAGGCATCTAGTTTCTCTGTGGCCATTATCCCACAGCTGATTGGTCCATTTTTGTAGATTTCCGCCATCATCTTTTCTCTCCCGCTGACTGACCCAAAGTCTCCCACCTTCCACAGAGTGTAATTGGAGATGTTGAAGCACTTCCCGAAGGTCACACACGTGCCGCACTGGTTAAACGTGTCGCATTTTTGGTCTTTGGCTTGGTAGTTGTTGCAGGTCTCGTCAGGAATCCCGTGACTGTTTGCGTACTCCCAGACACCTCCNTGGTCTCCTCCCTCGCANGACCCTGCATTGGCGCAATCAATGACGTGCTGAACAGATAGGTAAGCCGAGGGCCACACCCCATTGCGCTTGATATTAATCCTGTCTGCCATGGCACTAATGCTCCCATGAGCCCAACAAGAGCCACATACCTGGGGGATGTGCTGGTTGCGGGTGGGGCTTAACTAGTTTTTTTCATTCCCATTTGCGCCCGTCCAAGGCCTTTTGGCAGGTCCAAAACCCAAAAATGATTCTCGTGCGGCCCGCCTGGAAATTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGGAGAATGGGGTCAC