ORFeome > ctu1 ORF1 – XORFeome v1.0

ctu1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ctu1
Gene ID: 5872246
Gene Page ID: 5872209
ORF Xenbase ID: 17271321

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123240
Original XGC clone length: 1026

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ838247
dbEST ID: 79655949
Trimmed Sequence: ATGCCTGTCAAATGTAGTAGCTGTGAAGAATGGCGCGCAGTGCTACGAAGGCCAAAGACTGGTCATTCCTTGTGCAAGGATTGCTTTTTTTATGCGTTTGAGGAAGAAATTCACAATACCATTGTATCTGCAAAACTTTTCCATCCTGGTGAAAAGGTTGGTATTGGAGCTTCAGGTGGTAAGGACTCTACTGTGCTTGCCCATGTTATGAAGGTGCTAAATGAGCGCTATGCTTATGGGCTGGATTTAATCCTGTTGTCTGTGGATGAAGGCATTTCAGGGTATCGTGACGATTCTCTACAGACAGTGAAGAGAAACCAGCAGCAATATGAGTTGCCTCTTAAGATTGTTTCCTACCTAGAGCTTTATGGCTGGACAATGGATCAGATTGTAAAGCAGGTTGGCCTCAAGAATAATTGCACCTTCTGTGGTGTCTTCCGTAGACAGGCTCTGGATCGTGGTGCCATGATGTTGGGCATTAACAAAATCTGCACAGGGCACAATGCTGATGACATAGCAGAGACTGTGTTGATGAATTTCTTGAGAGGAGACATTGCACGACTGAGGCGTTGCACAGCTATAACCACAGGCAGTGAGGGTGCCATACCAAGATGCAAGCCTTTAAAGTATACTTATGAGAAAAAGATTGTGCTATATGCTTACTTCAAGAAACTGGACTACTTTTCTACAGAATGTAATTACTCTCCTAATGCCTACCGTGGGCCATGCCAAAGCCTTTCCTTAAAAACCCTGAAGGCCTTAAGGCCAAGCTCCGTCCTCCAACTTTATTCCCTCCTGGGGAAAAATTTTCCCTTTAAAA
Full Trace Sequence: GCGGGGCCCAATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTGTCAAATGTAGTAGCTGTGAAGAATGGCGCGCAGTGCTACGAAGGCCAAAGACTGGTCATTCCTTGTGCAAGGATTGCTTTTTTTATGCGTTTGAGGAAGAAATTCACAATACCATTGTATCTGCAAAACTTTTCCATCCTGGTGAAAAGGTTGGTATTGGAGCTTCAGGTGGTAAGGACTCTACTGTGCTTGCCCATGTTATGAAGGTGCTAAATGAGCGCTATGCTTATGGGCTGGATTTAATCCTGTTGTCTGTGGATGAAGGCATTTCAGGGTATCGTGACGATTCTCTACAGACAGTGAAGAGAAACCAGCAGCAATATGAGTTGCCTCTTAAGATTGTTTCCTACCTAGAGCTTTATGGCTGGACAATGGATCAGATTGTAAAGCAGGTTGGCCTCAAGAATAATTGCACCTTCTGTGGTGTCTTCCGTAGACAGGCTCTGGATCGTGGTGCCATGATGTTGGGCATTAACAAAATCTGCACAGGGCACAATGCTGATGACATAGCAGAGACTGTGTTGATGAATTTCTTGAGAGGAGACATTGCACGACTGAGGCGTTGCACAGCTATAACCACAGGCAGTGAGGGTGCCATACCAAGATGCAAGCCTTTAAAGTATACTTATGAGAAAAAGATTGTGCTATATGCTTACTTCAAGAAACTGGACTACTTTTCTACAGAATGTAATTACTCTCCTAATGCCTACCGTGGGCCATGCCAAAGCCTTTCCTTAAAAACCCTGAAGGCCTTAAGGCCAAGCTCCGTCCTCCAACTTTATTCCCTCCTGGGGAAAAATTTTCCCTTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTGTCAAATGTAGTAGCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838246
dbEST ID: 79655948
Trimmed Sequence: ATGAACTACTGCCCTCAGCTTCCTTTCCTCCTGCTCACTCAGGGGTTCCTGTGACAGCAGTTTGTGGTGAAGTTTATGGTGTTTTCCTATACCCAGCTTAGGTAGGCCACGGTTCAGACCCTCCAGCAGCACACATGCCTTGCAGAGGCTCTGGCTGGATATATAGCCACAGCGAGTGCAAGTCCCTTGCACAGGCATTCTAACATCCTCATTTACAGATAAATTCTCCCCAGAGTGAATAATGTCGATGATGGAGCTTGGCCTAATGGCCTCCAGGTCTTTAAGAAAGACTCTGGCATGGCCACGGTAGGCATTAGGAGAGTAAATACACTCTGTAGAAAAGTAGTCCAGTTTCTTGAAGTAAGCATATAGCACAATCTCTTTCTCATAAGTATACTTTAAAGGCTTGCATCTTGGTATGGCACCCTCACTGCCTGTGGTTATAGCTGTGCAACGCCTCAGTCGTGCAATGTCTCCTCTCAAGAAATTCATCAACACAGTCTCTGCTATGTCATCATCATTGTGCCCTGTGCAGATTTTGTTAATGCCCAACATCATGGCACCACGATCCAAAGCCTGTCTACGGAAAACACCACAAAAGGTGCAATTATTCTTGAGGCCAACCTGCTTTACAATCTGAATCCATTGTCCAACCATAAAGCCTCTAGGTAAGAAAACAGTCTTTAAAAAGCCACCTCCTAATTGCCTGTCTGGTTTTCGCGTTCATTTTTCCTGTTAAAAAAAATCCGTCCCGAAATACCCCCTTGAAATTCCCCC
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGAACTACTGCCCTCAGCTTCCTTTCCTCCTGCTCACTCAGGGGTTCCTGTGACAGCAGTTTGTGGTGAAGTTTATGGTGTTTTCCTATACCCAGCTTAGGTAGGCCACGGTTCAGACCCTCCAGCAGCACACATGCCTTGCAGAGGCTCTGGCTGGATATATAGCCACAGCGAGTGCAAGTCCCTTGCACAGGCATTCTAACATCCTCATTTACAGATAAATTCTCCCCAGAGTGAATAATGTCGATGATGGAGCTTGGCCTAATGGCCTCCAGGTCTTTAAGAAAGACTCTGGCATGGCCACGGTAGGCATTAGGAGAGTAAATACACTCTGTAGAAAAGTAGTCCAGTTTCTTGAAGTAAGCATATAGCACAATCTCTTTCTCATAAGTATACTTTAAAGGCTTGCATCTTGGTATGGCACCCTCACTGCCTGTGGTTATAGCTGTGCAACGCCTCAGTCGTGCAATGTCTCCTCTCAAGAAATTCATCAACACAGTCTCTGCTATGTCATCATCATTGTGCCCTGTGCAGATTTTGTTAATGCCCAACATCATGGCACCACGATCCAAAGCCTGTCTACGGAAAACACCACAAAAGGTGCAATTATTCTTGAGGCCAACCTGCTTTACAATCTGAATCCATTGTCCAACCATAAAGCCTCTAGGTAAGAAAACAGTCTTTAAAAAGCCACCTCCTAATTGCCTGTCTGGTTTTCGCGTTCATTTTTCCTGTTAAAAAAAATCCGTCCCGAAATACCCCCTTGAAATTCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGAACTACTGCCCTCAGCTT