ORFeome > ctu2 ORF1 – XORFeome v1.0

ctu2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ctu2
Gene ID: 6466467
Gene Page ID: 5732027
ORF Xenbase ID: 17271327

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124921
Original XGC clone length: 1539

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ837578
dbEST ID: 79655280
Trimmed Sequence: ATGTGTGAGGAGGGAGAGACTTACTGTCCTGAAGTAAAGGATGCAAAACAAGGCAAAAGCCTTGGAAAAATATGTATGAAATGCAAGGAAAGTTCTGCTGCCCTTCTCATCCGAGCTGGAGATGCATTCTGCAAATCCTGCTTCAAAGAGTACTTTGTGCACAAGTTCCGGGCCACTCTTGGCAAGAACAGAGTCATCTATCCAGGGGAAAAGGTTCTCTTGGCTTATTCCGGTGGTCCCTCCTCCAGTGCCATGGTCCGGCAAGTTCAGGAGGGACTGAGTCGTGATGCCCCTAAAAAGTTGCGCTTTGTTCCTGGAATCCTTTTTATTGATGAAGGCACAGCATGTGGCATGAGTTGGGAGGAACGTCAACAAATTCTGTCTGAGATTTGCAGTGTCCTTCAACAGACAAAGATTCCCTTTCACATTGTCTCTTTGGAGCAGGTTTTTTCCTTGCCAGGCTCTGTCCTGCACAGAGGTGCGCCTGAACAGAGACCAAATTACAAAGAAGAAGTGGATCGTTTCTTGGTGCAGGAGCGGGAGCAAGGAGATGCAGGATGTTCAGAAATGCTGGAAAGGCTTGAGGTCACTGACTCAGATTCACCTGAAAATAGTGATAAAATGTAACAAAGTAAATGCAACCATCCTCCCTGAACTGCACAACCCGAACACAAAAAAAAATTCAAATTCTTCTTCCCATAACTTTTGACTGCCTTAACAGACAATTTGCTTTCATTACTTCTGGAGGAACCCCCCGAGGTCCTCTCCCATATCTGCGGGGGAAAATTTGTG
Full Trace Sequence: GGCGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGTGAGGAGGGAGAGACTTACTGTCCTGAAGTAAAGGATGCAAAACAAGGCAAAAGCCTTGGAAAAATATGTATGAAATGCAAGGAAAGTTCTGCTGCCCTTCTCATCCGAGCTGGAGATGCATTCTGCAAATCCTGCTTCAAAGAGTACTTTGTGCACAAGTTCCGGGCCACTCTTGGCAAGAACAGAGTCATCTATCCAGGGGAAAAGGTTCTCTTGGCTTATTCCGGTGGTCCCTCCTCCAGTGCCATGGTCCGGCAAGTTCAGGAGGGACTGAGTCGTGATGCCCCTAAAAAGTTGCGCTTTGTTCCTGGAATCCTTTTTATTGATGAAGGCACAGCATGTGGCATGAGTTGGGAGGAACGTCAACAAATTCTGTCTGAGATTTGCAGTGTCCTTCAACAGACAAAGATTCCCTTTCACATTGTCTCTTTGGAGCAGGTTTTTTCCTTGCCAGGCTCTGTCCTGCACAGAGGTGCGCCTGAACAGAGACCAAATTACAAAGAAGAAGTGGATCGTTTCTTGGTGCAGGAGCGGGAGCAAGGAGATGCAGGATGTTCAGAAATGCTGGAAAGGCTTGAGGTCACTGACTCAGATTCACCTGAAAATAGTGATAAAATGTAACAAAGTAAATGCAACCATCCTCCCTGAACTGCACAACCCGAACACAAAAAAAAATTCAAATTCTTCTTCCCATAACTTTTGACTGCCTTAACAGACAATTTGCTTTCATTACTTCTGGAGGAACCCCCCGAGGTCCTCTCCCATATCTGCGGGGGAAAATTTGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTGAGGAGGGAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837577
dbEST ID: 79655279
Trimmed Sequence: TGAGTCCCCATCGTCTTCATCAAGCAGAAACTCCTGTATCTCCTTCCTCATCTCAGTCCTGTGACAGCGGTGCTCTGCTTCATGAAGCACATACTGGGGTAAGACATCAAGAGACTGCATGTCCTTTACTGTAAGCCTGCAACTATAGCATAACATGTGAACAAAGCTGGGAGTCTGGAGAGCCCGTGACTGGCAGGTGTCCCCATAACCTGCTTCTTTACAGCCCTGACCCCCTTGGCAGCAAGACTTGTCAGAATTGTTTGCAAGATCATTCGATTTCATAGGAATCTTCTGAGAAAGGTGATGCGATAGCTGCGTGGCAGAGAAAGCAGAGGCCTTGCCCGCTTGAGTGTCTAGAGGGGAAAGACATAACAAGCATCTATCTTTTGCACAGGTCTCTTGGTCTGCGTCTATTTTGGATACATTCAGCTTCTCACTGGTCCTGTACAGGGTGCTCACAGTGGATGGGAAATCTGCCTGCAGTCTGTTGACGAAAACCTCTGTAAGGTGCTGAATGCTGCTGTTCTCTGAAGCCTTAGTGTCCAATGCTGGGATGAAAATTGGCGAGACATTGAAAAATCGGTTATAGTAGGCAATTTCCTTTGAAGAATATTCTCTCATAAGACGGATGATATCAACATCCCCATATCTGCTGTCACAAAAACCAGTATCCCGTTGGTAGAAAGGCTCCCCCGTTCCAGGGAAAACGTTTGAAAAGCCACCCCGATGGAAGAAAAACAAAATAACAGCTCTTCACAAGTCCATCC
Full Trace Sequence: GGGAATAGGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGAGTCCCCATCGTCTTCATCAAGCAGAAACTCCTGTATCTCCTTCCTCATCTCAGTCCTGTGACAGCGGTGCTCTGCTTCATGAAGCACATACTGGGGTAAGACATCAAGAGACTGCATGTCCTTTACTGTAAGCCTGCAACTATAGCATAACATGTGAACAAAGCTGGGAGTCTGGAGAGCCCGTGACTGGCAGGTGTCCCCATAACCTGCTTCTTTACAGCCCTGACCCCCTTGGCAGCAAGACTTGTCAGAATTGTTTGCAAGATCATTCGATTTCATAGGAATCTTCTGAGAAAGGTGATGCGATAGCTGCGTGGCAGAGAAAGCAGAGGCCTTGCCCGCTTGAGTGTCTAGAGGGGAAAGACATAACAAGCATCTATCTTTTGCACAGGTCTCTTGGTCTGCGTCTATTTTGGATACATTCAGCTTCTCACTGGTCCTGTACAGGGTGCTCACAGTGGATGGGAAATCTGCCTGCAGTCTGTTGACGAAAACCTCTGTAAGGTGCTGAATGCTGCTGTTCTCTGAAGCCTTAGTGTCCAATGCTGGGATGAAAATTGGCGAGACATTGAAAAATCGGTTATAGTAGGCAATTTCCTTTGAAGAATATTCTCTCATAAGACGGATGATATCAACATCCCCATATCTGCTGTCACAAAAACCAGTATCCCGTTGGTAGAAAGGCTCCCCCGTTCCAGGGAAAACGTTTGAAAAGCCACCCCGATGGAAGAAAAACAAAATAACAGCTCTTCACAAGTCCATCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAGTCCCCATCGTCTTCAT