ORFeome > cxadr ORF1 – XORFeome v1.0

cxadr ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cxadr
Gene ID: 922491
Gene Page ID: 922482
ORF Xenbase ID: 17271417

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC154970
Original XGC clone length: 1044

Human orthology & disease relationships

NCBI Entrez ID: 1525
Ensembl gene IDs: ENSG00000154639
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 145500,203450,245349,252010,256000,607322

Library Location

Plate ID: GDExl11093
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ839056
dbEST ID: 79656758
Trimmed Sequence: ATGGATTCCCTCGCTGTCCTGTGGCTCCTGTTACTCGGCTCCGCTTCTACAAGAGCCCTGAAGGTGGACACAAATGAACCGAAAACATTTATAATGCCTCAAGGTGATAAAGTGCTTTTGGAATGTAAATTTTCGTTAGATCCACAGGACACAGGAACCTTAGATATTGAGTGGTCATTGGTGGCATCAGATACCCAACAAACTGATCAGCAGATAATTACTTTCGCTGGAGACCAAACATATACAATGTATGCAGAGCTGAAAGATAGAGTACATTTTGTCTCCAATGACCCCAAGACCGGAGATGCGACCATAGAAATCATTAACTTAAAGCAATCTGACAGTGGAACATACCAGTGCAAAGTAAAAAAAGTTCCAGGTGTGGGGAGCCGGAGGTTGACAGTGTCCGTTTTGGTTAAACCAGCAAAAACGAGGTGCTTTGTTGAAGGCACCCAGGAAATTGGGAGAGATCTCAGCTTGAAATGTGAATCCAAAGATGGGACCCCACCCCTTACATACTCATGGCAGAGACTTAGTGGACAAGGCAAGAATACTCCAGCTATAACACCAGATGCAACAACTGGATTTGTGGCGATAAAAAATGCATCTCANGAATACAGCGGCACCTACAGGTGTTTATCTCACAACAGAGTCCGAAAGTGACGAGTGTCTCGTCATACTTAATGTTGCTCCCCCCTCAAATGTGGCTGGAAAAATTGCCCGNTGCCTTTATTGGGACAATTGCCTGGGTCCTAAAACTTTCGGGCCCCCAACCAAAATTTTGGCTGC
Full Trace Sequence: TTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATTCCCTCGCTGTCCTGTGGCTCCTGTTACTCGGCTCCGCTTCTACAAGAGCCCTGAAGGTGGACACAAATGAACCGAAAACATTTATAATGCCTCAAGGTGATAAAGTGCTTTTGGAATGTAAATTTTCGTTAGATCCACAGGACACAGGAACCTTAGATATTGAGTGGTCATTGGTGGCATCAGATACCCAACAAACTGATCAGCAGATAATTACTTTCGCTGGAGACCAAACATATACAATGTATGCAGAGCTGAAAGATAGAGTACATTTTGTCTCCAATGACCCCAAGACCGGAGATGCGACCATAGAAATCATTAACTTAAAGCAATCTGACAGTGGAACATACCAGTGCAAAGTAAAAAAAGTTCCAGGTGTGGGGAGCCGGAGGTTGACAGTGTCCGTTTTGGTTAAACCAGCAAAAACGAGGTGCTTTGTTGAAGGCACCCAGGAAATTGGGAGAGATCTCAGCTTGAAATGTGAATCCAAAGATGGGACCCCACCCCTTACATACTCATGGCAGAGACTTAGTGGACAAGGCAAGAATACTCCAGCTATAACACCAGATGCAACAACTGGATTTGTGGCGATAAAAAATGCATCTCANGAATACAGCGGCACCTACAGGTGTTTATCTCACAACAGAGTCCGAAAGTGACGAGTGTCTCGTCATACTTAATGTTGCTCCCCCCTCAAATGTGGCTGGAAAAATTGCCCGNTGCCTTTATTGGGACAATTGCCTGGGTCCTAAAACTTTCGGGCCCCCAACCAAAATTTTGGCTGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATTCCCTCGCTGTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839055
dbEST ID: 79656757
Trimmed Sequence: AACCGCTGTTAAGCCATGATACTTGGAAGGAACGGAGTTTGGTGCTTGGCTTGGGGGGCGCTCAAACTCTTCATTGGGTATTTTATTGTACTGAGCTTTGGAGTAGCCTTCCATGTTCGAGGGAGACAGAGAGCCAAGAGAAGAGTGATTACTCCCGATATAACTGCGAGCGGTGGAATTGCGGCTTTTGGGCGGAGCAACGTCCTCTCTGATCTCATGCTGTACTTCTTTCTCATATTTCTTCTCTTTTTGCTTTCTGCAGCAGCAAAATATGATGAGGGCCAGAAGTATAAGACCAAGCAATGTTCCAATAACGGCACCGGCAATTTTTCCAGCCACATTTGAAGGGGGAGCAACATTAAGTATGAGGAGACACTCGTCACTTCCGACTCTGTTGTGAGATAAACACCTGTAGGTGCCGCTGTATTCCTGAGATGCATTTTTTATCGCCACAAATCCAGTTGTTGCATCTGGTGTTATAGCTGGAGTATTCTTGCCTTGTCCACTAAGTCTCTGCCATGAGTATGTAAGGGGTGGGGTCCCATCTTTGGATTCACATTTCAAGCTGAGATCTCTCCCAATTTCCTGGGTGCCTTCCACAAAGCACCTCCTTTTTTGCTGGTTTAACCAAAAACGAACACCTGTCAACCCTCCGGCCTCCCCACACCCGGGGAACTTTTTTTTACTTTTCCACTGGTAATGTGCCCCCTTGGCCAAAATTGCTTTTAAAGTTTAAATAAATTTCCCATATGGGCCCCCC
Full Trace Sequence: GGGAAACATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACCGCTGTTAAGCCATGATACTTGGAAGGAACGGAGTTTGGTGCTTGGCTTGGGGGGCGCTCAAACTCTTCATTGGGTATTTTATTGTACTGAGCTTTGGAGTAGCCTTCCATGTTCGAGGGAGACAGAGAGCCAAGAGAAGAGTGATTACTCCCGATATAACTGCGAGCGGTGGAATTGCGGCTTTTGGGCGGAGCAACGTCCTCTCTGATCTCATGCTGTACTTCTTTCTCATATTTCTTCTCTTTTTGCTTTCTGCAGCAGCAAAATATGATGAGGGCCAGAAGTATAAGACCAAGCAATGTTCCAATAACGGCACCGGCAATTTTTCCAGCCACATTTGAAGGGGGAGCAACATTAAGTATGAGGAGACACTCGTCACTTCCGACTCTGTTGTGAGATAAACACCTGTAGGTGCCGCTGTATTCCTGAGATGCATTTTTTATCGCCACAAATCCAGTTGTTGCATCTGGTGTTATAGCTGGAGTATTCTTGCCTTGTCCACTAAGTCTCTGCCATGAGTATGTAAGGGGTGGGGTCCCATCTTTGGATTCACATTTCAAGCTGAGATCTCTCCCAATTTCCTGGGTGCCTTCCACAAAGCACCTCCTTTTTTGCTGGTTTAACCAAAAACGAACACCTGTCAACCCTCCGGCCTCCCCACACCCGGGGAACTTTTTTTTACTTTTCCACTGGTAATGTGCCCCCTTGGCCAAAATTGCTTTTAAAGTTTAAATAAATTTCCCATATGGGCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACCGCTGTTAAGCCATGA