ORFeome > cxcr4 ORF1 – XORFeome v1.0

cxcr4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cxcr4
Gene ID: 6256540
Gene Page ID: 489916
ORF Xenbase ID: 17271447

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044963
Original XGC clone length: 1077

Human orthology & disease relationships

NCBI Entrez ID: 7852
Ensembl gene IDs: ENSG00000121966,LRG_51
Directly associated (OMIM) disease MIM numbers: 193670
Indirectly associated (Lage, et al.) disease MIM numbers: 193670,275355,609423

Library Location

Plate ID: GDExl11010
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ823857
dbEST ID: 79641559
Trimmed Sequence: ATGGACGGGTTTTCTGGTGGCATTGATATCAATATTTTTGATGGCAACTCCACAGAGAATGGTTCCGGTGACTTTGAGGATTTCATTGAGCCATGTTTCATGCAAGAAAACAGTGACTTTAACAGGATCTTCTTGCCAACAATCTACTCCTTCATCTTCCTGCTGGGCATCATTGGGAATGGACTGGTGGTGGTGGTCATGGGCTATCAAAAGAAATCCAGGACCATGACAGACAAGTATAGGCTGCACCTTTCTGTCGCTGACCTGCTTTTTGTGTTCACCCTGCCCTTTTGGTCTGTGGATGCTGCCATTGGATGGTACTTTAAAGAGTTCCTTTGTAAGGCTGTCCATGTCATTTATACTGTCAACCTGTACAGCAGCGTTCTCATTTTGGCATTCATCAGCCTCGATCGCTACTTGGCCATTGTCCATGCGACCAACAGCCAAGGCTCACGGAAGATGCTGGCGGACAAAGTGGTGTACGCTGGCGTGTGGCTGCCAGCCCTTCTGTTGACAGTGCCGGACTTGGTGTTTGCTAGTGTCAGCAATGAAAATGGTCAGTTTGTTTGCGACCGCATTTACCCCATTGATAACCGGGAAACATGGACTGTTGGGTTTAGATTCCTGCACATAACTGTTGGCCTTATCTTGCCTGGTCTGATCATTCTGGGTCTGTTACTGTGTCATCATATCAAAGCTTTCTCATTCCCAGGGGACACCAAAAGCGCAAAACCTTAAAGACCAACTGTCATCCTCAATCTTGGCCCTTCTTCCCCCGGTTGGGCTTC
Full Trace Sequence: ATGGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACGGGTTTTCTGGTGGCATTGATATCAATATTTTTGATGGCAACTCCACAGAGAATGGTTCCGGTGACTTTGAGGATTTCATTGAGCCATGTTTCATGCAAGAAAACAGTGACTTTAACAGGATCTTCTTGCCAACAATCTACTCCTTCATCTTCCTGCTGGGCATCATTGGGAATGGACTGGTGGTGGTGGTCATGGGCTATCAAAAGAAATCCAGGACCATGACAGACAAGTATAGGCTGCACCTTTCTGTCGCTGACCTGCTTTTTGTGTTCACCCTGCCCTTTTGGTCTGTGGATGCTGCCATTGGATGGTACTTTAAAGAGTTCCTTTGTAAGGCTGTCCATGTCATTTATACTGTCAACCTGTACAGCAGCGTTCTCATTTTGGCATTCATCAGCCTCGATCGCTACTTGGCCATTGTCCATGCGACCAACAGCCAAGGCTCACGGAAGATGCTGGCGGACAAAGTGGTGTACGCTGGCGTGTGGCTGCCAGCCCTTCTGTTGACAGTGCCGGACTTGGTGTTTGCTAGTGTCAGCAATGAAAATGGTCAGTTTGTTTGCGACCGCATTTACCCCATTGATAACCGGGAAACATGGACTGTTGGGTTTAGATTCCTGCACATAACTGTTGGCCTTATCTTGCCTGGTCTGATCATTCTGGGTCTGTTACTGTGTCATCATATCAAAGCTTTCTCATTCCCAGGGGACACCAAAAGCGCAAAACCTTAAAGACCAACTGTCATCCTCAATCTTGGCCCTTCTTCCCCCGGTTGGGCTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGGGTTTTCTGGTGGCATT

Sequences - 3ʹ (reverse) EST

Accession: JZ829165
dbEST ID: 79646867
Trimmed Sequence: GCTCGAGTGAAAACTGGAGGATTCGGATTCTGTTGAGACAGAAGAAAGTCCGGCTCGTTTTTTGGATAATATTTTTAAGCTTGAGCCTCTGCTGACTGAGGTGAATGCGTTCTGAGCAGACTTCTTGAATTTGGCCCCGAGGAAGGCATACAGGATGGGGTTAAGGCAGCAGTGGAAGAAGGCTAAAGCTTCTGTGATGGATATGGCCTTGTGTAGGGTGTTCTCCCAAATGCAGTCTGCCTTCACCAGCCCAAGCATCATGAATGTGTCGGTAGTGAGGCATACATAATATGGAAGCCAACAGGCGAAGAAGGCCAAGATGAGGATGACAGTGGTCTTTAAGGCTTTGCGCTTCTGGTGTCCCTTGGAATGAGAAAGCTTTGATATGATGACACAGTAACAGACCAGAATGATCAGACCAGGCAAGATAAGGCCAACAGTTATGTGCAGGAATCTAAACCCAACAGTCCATGTTTCCCGGTTATCAATGGGGTAAATGCGGTCGCAAACAAACTGACCATTTTCATTGCTGACACTAGCAAACACCAAGTCCGGCACTGTCAACAGAAGGGCTGGCAGCCACACGCCAGCGTACACCACTTTGTCCGCCAGCATCTTCCGTGAGCCTTGGGCTGTTGGTCGCATGGACAATGGGCAAGTAGCGATCGAGGCTGATGAATGCCAAAATGAGGACGCCTGCTGTTACGGGTTGACAGTTATAAATGACCTTGGACGGCCCTTACAAAGGGAACCTCCTTTAAAA
Full Trace Sequence: GGGCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTCGAGTGAAAACTGGAGGATTCGGATTCTGTTGAGACAGAAGAAAGTCCGGCTCGTTTTTTGGATAATATTTTTAAGCTTGAGCCTCTGCTGACTGAGGTGAATGCGTTCTGAGCAGACTTCTTGAATTTGGCCCCGAGGAAGGCATACAGGATGGGGTTAAGGCAGCAGTGGAAGAAGGCTAAAGCTTCTGTGATGGATATGGCCTTGTGTAGGGTGTTCTCCCAAATGCAGTCTGCCTTCACCAGCCCAAGCATCATGAATGTGTCGGTAGTGAGGCATACATAATATGGAAGCCAACAGGCGAAGAAGGCCAAGATGAGGATGACAGTGGTCTTTAAGGCTTTGCGCTTCTGGTGTCCCTTGGAATGAGAAAGCTTTGATATGATGACACAGTAACAGACCAGAATGATCAGACCAGGCAAGATAAGGCCAACAGTTATGTGCAGGAATCTAAACCCAACAGTCCATGTTTCCCGGTTATCAATGGGGTAAATGCGGTCGCAAACAAACTGACCATTTTCATTGCTGACACTAGCAAACACCAAGTCCGGCACTGTCAACAGAAGGGCTGGCAGCCACACGCCAGCGTACACCACTTTGTCCGCCAGCATCTTCCGTGAGCCTTGGGCTGTTGGTCGCATGGACAATGGGCAAGTAGCGATCGAGGCTGATGAATGCCAAAATGAGGACGCCTGCTGTTACGGGTTGACAGTTATAAATGACCTTGGACGGCCCTTACAAAGGGAACCTCCTTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTCGAGTGAAAACTGGAGG