ORFeome > cxorf56 ORF1 – XORFeome v1.0

cxorf56 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cxorf56
Gene ID: 5808712
Gene Page ID: 5808637
ORF Xenbase ID: 17271471

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084870
Original XGC clone length: 669

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ840014
dbEST ID: 79657716
Trimmed Sequence: ATGCCGAAAGTAGTTTCGCGGTCTGTAGTTTGTTCGGATACCAGAGACCGCGAGGAGTACGACGATGGCGAAAAGCCACTGCACGTGTATTATTGTCTATGCGGGCAGATGGTGTTGGTTCTAGATTGCCAGCTCGAGAAACTTCCCATGAGGCCAAGAGATAGAGCAAGAGTTATAGGTGCAGCAAAACATGCTCATAAGTTCTGCAACACTGAGGAGGAGGAGCCTGTGTATTTGCGCAGGTCAGATGGCATTGAACGACAATACAGGAAAAAGTGCAGTAAGTGTAGCCTTCTTCTCTTCTATCAACACAGCCAAAAGAATGCGGCGGCCACTTTCATAGTGAATGGAGCCCTTGTCAAGTTTGGACAAGGTTTTGGGAAAACAAGTATTTATACTCAAAAACCAAACCCACCAAAGAAGGTGATGATGACCAAGCGTACAAAGGACATGGGTAAATTCAGTTCTGTCACTGTATCGACAATTGATGAAGAAGAGGAAGAGATTGAAGCAAGAGAAGTTGCAGATTCCTATGCCCAAAATGCCAAATTGATTGAAAAGCAGCTGGGAAAGAAAAGGAATGAACAAGAGGAGGCTGCAGGAATTGGCTGATTTGGAAGCTAAAAAGCCCAAATGAAAGGGGACCCTATTTGACATCAGTTTCAAATTGCCAACTTTCCTGGACAAGTTTGGCTTTATAAAAAAACATTGTTAATCAATTTGTTGGCAGAAAACGGGGTCCTTATTAATTCAAAAATAAAATCAATAATTTGGCACGCCCCGCTGGATAACCCCCCCAAATGGAG
Full Trace Sequence: CGGGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGAAAGTAGTTTCGCGGTCTGTAGTTTGTTCGGATACCAGAGACCGCGAGGAGTACGACGATGGCGAAAAGCCACTGCACGTGTATTATTGTCTATGCGGGCAGATGGTGTTGGTTCTAGATTGCCAGCTCGAGAAACTTCCCATGAGGCCAAGAGATAGAGCAAGAGTTATAGGTGCAGCAAAACATGCTCATAAGTTCTGCAACACTGAGGAGGAGGAGCCTGTGTATTTGCGCAGGTCAGATGGCATTGAACGACAATACAGGAAAAAGTGCAGTAAGTGTAGCCTTCTTCTCTTCTATCAACACAGCCAAAAGAATGCGGCGGCCACTTTCATAGTGAATGGAGCCCTTGTCAAGTTTGGACAAGGTTTTGGGAAAACAAGTATTTATACTCAAAAACCAAACCCACCAAAGAAGGTGATGATGACCAAGCGTACAAAGGACATGGGTAAATTCAGTTCTGTCACTGTATCGACAATTGATGAAGAAGAGGAAGAGATTGAAGCAAGAGAAGTTGCAGATTCCTATGCCCAAAATGCCAAATTGATTGAAAAGCAGCTGGGAAAGAAAAGGAATGAACAAGAGGAGGCTGCAGGAATTGGCTGATTTGGAAGCTAAAAAGCCCAAATGAAAGGGGACCCTATTTGACATCAGTTTCAAATTGCCAACTTTCCTGGACAAGTTTGGCTTTATAAAAAAACATTGTTAATCAATTTGTTGGCAGAAAACGGGGTCCTTATTAATTCAAAAATAAAATCAATAATTTGGCACGCCCCGCTGGATAACCCCCCCAAATGGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGAAAGTAGTTTCGCGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ840013
dbEST ID: 79657715
Trimmed Sequence: TTTGAACTGATTGTCAATTAGCGTCCCTTTCATCTTGGCTTTCTTAGCTTCCAACTCAGCCAACTCCTGCAGCCTCCTCTTGCTCATTCCTTTTCTTTCCAGCTGCTTTTCAATCACTTTGGCATTTTGGGCATAGGAATCTGCAACTTCTCTTGCTTCAATCTCCTCCTCTTCTTCATCAATTGTCGATACAGTGACAGAACTGAATTTACCCATGTCCTTTGTACGCTTGGTCATCATCACCTTCTTTGGTGGGTCTGGTTTTTGAGTATAAATACTTGTTTTCCCAAAACCTTGTCCAAACTTGACAAGGGCTCCATTCACTATGAAAGTGGCCGCCGCATTCTTTTGGCTGTGTTGATAGAAGAGAAGAAGGCTACACTTACTGCACTTTTTCCTGTATTGTCGTTCAATGCCATCTGACCTGCGCAAATACACAGGCTCCTCCTCCTCAGTGTTGCAGAACTTATGAGCATGTTTTGCTGCACCTATAACTCTTGCTCTATCTCTTGGCCTCGTGGGAAGTTTCTCGAGCTGGCAATCTAAAAAACACACCATCTGCCCGCATAGACAATAATACACGTGCAATGGCCTTTCGCCATCGTCCTAACTCCTCGCCGTCTCTGGTATCCGAAAAAAACTATAAACGCGAAAACTAATTTTCGCCATGGTGCCAACTTTTTTTGTAAAAAGTTGACAATTAAAA
Full Trace Sequence: GGCAAAATGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGAACTGATTGTCAATTAGCGTCCCTTTCATCTTGGCTTTCTTAGCTTCCAACTCAGCCAACTCCTGCAGCCTCCTCTTGCTCATTCCTTTTCTTTCCAGCTGCTTTTCAATCACTTTGGCATTTTGGGCATAGGAATCTGCAACTTCTCTTGCTTCAATCTCCTCCTCTTCTTCATCAATTGTCGATACAGTGACAGAACTGAATTTACCCATGTCCTTTGTACGCTTGGTCATCATCACCTTCTTTGGTGGGTCTGGTTTTTGAGTATAAATACTTGTTTTCCCAAAACCTTGTCCAAACTTGACAAGGGCTCCATTCACTATGAAAGTGGCCGCCGCATTCTTTTGGCTGTGTTGATAGAAGAGAAGAAGGCTACACTTACTGCACTTTTTCCTGTATTGTCGTTCAATGCCATCTGACCTGCGCAAATACACAGGCTCCTCCTCCTCAGTGTTGCAGAACTTATGAGCATGTTTTGCTGCACCTATAACTCTTGCTCTATCTCTTGGCCTCGTGGGAAGTTTCTCGAGCTGGCAATCTAAAAAACACACCATCTGCCCGCATAGACAATAATACACGTGCAATGGCCTTTCGCCATCGTCCTAACTCCTCGCCGTCTCTGGTATCCGAAAAAAACTATAAACGCGAAAACTAATTTTCGCCATGGTGCCAACTTTTTTTGTAAAAAGTTGACAATTAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGAACTGATTGTCAATTAGCGT