ORFeome > cyb5r3 ORF1 – XORFeome v1.0

cyb5r3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cyb5r3
Gene ID: 962421
Gene Page ID: 962417
ORF Xenbase ID: 17271531

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045265
Original XGC clone length: 906

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: ACAATAAAGTATTTTTTTTTTCACGGTAATGGACCGGTCCTTTCCCCAAATTGTTAACAAAGGTTTTTTTTATGGCCCCTTTTTCAAAAAATTTGCGCCCAGGCTGCCTCTCACTATAACCAGTGCACATGTACGGTGCTGGGGCTAATAAAGAGAACGATAAAACCGCCCGTCTTTCTTCCTTTATAGCAGCCATTGCCATTGGATACTTGGTTACTTGTTCATTGGGACCCGATGGACTGGACTAATATTCCCCGCAGCTGTGGCCCAAATGGCGGTGTTACTGTAGCCAAGGAAGGAGCAGCTATCCTGAAATCGAGTGGTGTTGACAACCCTGCTGCGGAGGGTTTGGTAGACATGTAGAAAATCCAGGATGATAAAGTAAGTGATCGGAACACCATCACTGCAGGTGCTGGCAGACGAATCCTCTCATATGGGCAGAAATTGCTGGTGGATAAAACTATTCACCCTCAGACTACCATGTCAGTATGGAGACAAGACACACACTTCGCCAGACACGCACTCCTTAAAGCAACTCCGCATCCTGGGAACGATAAAAAGAAGTTCCACTGTGACCTTTTGAATATATCCCGCAGTAGATTGTCGTCTAAGCTTCTCACCCGCCAGAAAGAGCACTATGCTCAAACTGGCTACGGATGCTGTCTATCCTATTTGAAGGATCTGGCAACTTGAAAGTATTTCATTGTCATTAAACAGCTACGGGGAATCTGAACAGACTCCTACTTGGATAAAGGATCTTGCTTAATACAAAAAAGGAGTATATTCGCCCCACCCAATAGAGGAGGGAAAGAGCCGGATGCGCAACCCTTCATGGACCCGGCCTAAAAAAGGGCTGGGGTTCCGAAACAGGGGGAACCCCGCGGGGGGGGGGGGGGGGGGATTTAATTTGCAAAAAGAAAACGGGCGGGTATTTTCTTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGGCCCAGCTAAGCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ828934
dbEST ID: 79646636
Trimmed Sequence: GTAGGCGAATCTCCTGTCCTGGGGGTACGACAGCTTGTCCAGGCTGGGGTTGATTGCATATTGGACCATGGGAGGGGGGCCGCACATCAGGATCAGGACGTCGTCCCCGGGGGGAGGCATAAAGGAGCTGATCATGTCTTCATTGACAAAGCCCTGGCTGTAGTCCCAATCTTCAGGGGCTCGGTCTAGCGTGTACCACAGTTTGAAGCGGGACGGGTGGTTGGCGCGGATCTCCTCCAGTTCTGAGCGGAGCAGGATGTCTTTCTCCGTCTGGTTGGCAAAGAGCAAGTAGCAGATGGTTTTATCCTCCTTGTCCTTTAGGATGGCTCGAATGAGCTGCAGCATTGGGGTGATCCCTGTCCCACCAGCGATCATTCCCAGGTGATTTGCTTTTTTGGGGACCGGGGGGGACTTCTTGTCTGGGCGGATCTGGAAGGTCCCTTTGCCACTGTACACGAGAAGGCCGCTTGGTCCTCGGAAATCAATGGTTTCGTCTTTCCTCAGGGAGTCCAGATACTGGGACATCTTTCCACCCTCTGGGAATTGGGGGGTGGACGTTTTTAAAGTAGATCTTCACAACAAGGTCAACATAACCTTTATTATCATCGCTGGAAACTGGGGGTGTAGGGTCTGACCACCAGATTGCCGTCCACCCTCCGCGGAGGTAAATATGCTGCCCCCATGGGGAGGGCGAAGGACAGGCTCGGGGGGAAAGGGAGAGAAAACCGAAAACCTCCCCGGGGTTCATGGGGCTAAATTTCCTTTCCTTTC
Full Trace Sequence: CCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGGCGAATCTCCTGTCCTGGGGGTACGACAGCTTGTCCAGGCTGGGGTTGATTGCATATTGGACCATGGGAGGGGGGCCGCACATCAGGATCAGGACGTCGTCCCCGGGGGGAGGCATAAAGGAGCTGATCATGTCTTCATTGACAAAGCCCTGGCTGTAGTCCCAATCTTCAGGGGCTCGGTCTAGCGTGTACCACAGTTTGAAGCGGGACGGGTGGTTGGCGCGGATCTCCTCCAGTTCTGAGCGGAGCAGGATGTCTTTCTCCGTCTGGTTGGCAAAGAGCAAGTAGCAGATGGTTTTATCCTCCTTGTCCTTTAGGATGGCTCGAATGAGCTGCAGCATTGGGGTGATCCCTGTCCCACCAGCGATCATTCCCAGGTGATTTGCTTTTTTGGGGACCGGGGGGGACTTCTTGTCTGGGCGGATCTGGAAGGTCCCTTTGCCACTGTACACGAGAAGGCCGCTTGGTCCTCGGAAATCAATGGTTTCGTCTTTCCTCAGGGAGTCCAGATACTGGGACATCTTTCCACCCTCTGGGAATTGGGGGGTGGACGTTTTTAAAGTAGATCTTCACAACAAGGTCAACATAACCTTTATTATCATCGCTGGAAACTGGGGGTGTAGGGTCTGACCACCAGATTGCCGTCCACCCTCCGCGGAGGTAAATATGCTGCCCCCATGGGGAGGGCGAAGGACAGGCTCGGGGGGAAAGGGAGAGAAAACCGAAAACCTCCCCGGGGTTCATGGGGCTAAATTTCCTTTCCTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGGCGAATCTCCTGTCCTG