ORFeome > cyp2c8.1 ORF1 – XORFeome v1.0

cyp2c8.1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cyp2c8.1
Gene ID: 5820991
Gene Page ID: 5820978
ORF Xenbase ID: 17271621

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045126
Original XGC clone length: 1491

Human orthology & disease relationships

NCBI Entrez ID: 1558
Ensembl gene IDs: ENSG00000138115
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 139300,200950,231300,270200,300000,307030,604229,608902,609535

Library Location

Plate ID: GDExl11015
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AAAATTAATTCTTTTTTATCTTTATTTTTATACATGTACATCTTGTCTCCTTGCACATCGGAACATGTATACACATGTGATCTGTATTTTATANGACCACATGCCTTCTTCCTATAAAATGTCTAACTCTTCTCGCGTAAATAACACTGTGGGCAAAAGCCAATATGTGATTTCTCGTCTTAGGCACCCATATCTCTCCACACGAATTATTTGTGGTCACATCTCTCCTCGGGTCTTTATGCTAATTACATCCTACAAAGGGGGAGAGCGGTCACGCCAAAACAAATAAGCATATCTGCGCCTCCCTGCGAGACAAACGGTCATATTTTCCTCTGTGTTGGGCCCAAGTATTTATACTTAGTACGCGCATCTTCTCGAAGATTCCTCGCGCGTCCCCTTGATTTGGGGTAAGATGCACACCTCAGAGAGAGCCTGTCTGTACACCCGCGGCCAAACTCGGCGTGGTCCTCTCCGGAAAAAATCATCGCCCCAATCGCGGCATCCATGTCTTTTCTAAAAGGAAGGCATTTTATTCTACTCACAAACGCTCGCACTTTCGTTCCACACCTGTGCGCAGAGGTATGGGGGTATTTTTTGAAAGGTCTTTTTATAAAAAACATTGGTGTTATATGTCTGATACCCAACCGCACACATACCTGGGAGAGAAAAATGAAAACATCACAATAATATATAATCCACCTCTCTATGAATAAGCATTTTTGGCTGCGCCCCACACAGAAAAATATATAATTATGAAAGAAAAATACGAATGAAAAACCGCGAAGGCCTGCACGCCCAAAAAATATTACTTGAGTAATAAAAAGAAACCATCCCCCCTTCATTCTCAAGAGGAGGCCGCGCGCGGAGCCGACATAATCCCCCCAAAACCCCCCCAGATTACTATTTTTTTTTTTTTTGGGTGGGGTGTTGGGCGGTTTAAGAGAAAGGAAAAAAAAGGAGGAAAGCCCTACCCCAACTGCGCCCTGGAGGTGGGGTGTTGTCTCCATTTATCTTAAAAAAAAAAAAACAAAGAGGGGGTGGGGAGGGTGGCAACAACCCCCTTTCTTCAACATATAAGATTATAAAAGACCACATTAGTTTTATGGACCACTCTCCTCCCCTCCCCCCTCCCTCCCCTCTTTATTTTTTTCTCTTCGGGAGGGTATTACTAAACAATTTCAATGTAGTTTGTATGTTGTGGTGGGTGGGGATATGTCGTGCTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTAATGGATTCTGCTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829631
dbEST ID: 79647333
Trimmed Sequence: GCTACGAGGGACGACATACATCTTGTAGGGCCACGGTCGTGAAGCATTGGTGTTGGGTTCTGGGGTAATTGTAATATCTCTTGTATCCACAGTGGATTTTAAAATACATTTCTGTAAAATGGTAGTAAGAAATATGAAGAGCTCCATCCGAGCCAGTCCTTCCCCTGCGCACATACGTTTCCCTGAGGAAAATGGGAGAAAAGCATCATTTTTCTTAAAGAGGCCATTCTCATCTAGAAAGTGCCCAGGGTCAAACTGATCTGGATTTTTGAAGTATTTAGGATCCTTAAGCACAGAGGTTAGTACTGGAAATATCACAGTTCCCTTGGGAATGTAATATCCTCTAAAGATTGTGTCTTTGCTGGCTGCATGTTCCAATCCAAGTGGAATAATGTCTGCAAATCGTTGAACCTCATGGATTACAGCTTCAGTATATGGCATCTTGCTCCTGTCCTCGACTGATGGGCAGCGGCCTTGACCTATCACTTGATCAATCTCCTTATAGACCTTTTCTTGAATTTCTGGGTACTTGAGTAAAATAAGTAAGGCATATCTCAGTGTCAAACTTGTGGTCTCTGTCCCAGCTAAAAACAAATCGATGATGGTTCCAGACAATTTCTCATTGGTGAATTCACTGTTTAGGATTAATTTTTTNCCTCNTCCATTTTTATCAGGGAGCAGTCAATAAAGTTCCCCTGGGACAGTTTTGCACCCCAGCGGAAACTTTTTGTAGAAATTTTTGCCCTCATCCCCCTCACAAAACCCCTTTTTACC
Full Trace Sequence: GGGCGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTACGAGGGACGACATACATCTTGTAGGGCCACGGTCGTGAAGCATTGGTGTTGGGTTCTGGGGTAATTGTAATATCTCTTGTATCCACAGTGGATTTTAAAATACATTTCTGTAAAATGGTAGTAAGAAATATGAAGAGCTCCATCCGAGCCAGTCCTTCCCCTGCGCACATACGTTTCCCTGAGGAAAATGGGAGAAAAGCATCATTTTTCTTAAAGAGGCCATTCTCATCTAGAAAGTGCCCAGGGTCAAACTGATCTGGATTTTTGAAGTATTTAGGATCCTTAAGCACAGAGGTTAGTACTGGAAATATCACAGTTCCCTTGGGAATGTAATATCCTCTAAAGATTGTGTCTTTGCTGGCTGCATGTTCCAATCCAAGTGGAATAATGTCTGCAAATCGTTGAACCTCATGGATTACAGCTTCAGTATATGGCATCTTGCTCCTGTCCTCGACTGATGGGCAGCGGCCTTGACCTATCACTTGATCAATCTCCTTATAGACCTTTTCTTGAATTTCTGGGTACTTGAGTAAAATAAGTAAGGCATATCTCAGTGTCAAACTTGTGGTCTCTGTCCCAGCTAAAAACAAATCGATGATGGTTCCAGACAATTTCTCATTGGTGAATTCACTGTTTAGGATTAATTTTTTNCCTCNTCCATTTTTATCAGGGAGCAGTCAATAAAGTTCCCCTGGGACAGTTTTGCACCCCAGCGGAAACTTTTTGTAGAAATTTTTGCCCTCATCCCCCTCACAAAACCCCTTTTTACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTACGAGGGACGACATACA