ORFeome > cyp2d6-B-prov ORF1 – XORFeome v1.0

cyp2d6-B-prov ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: unnamed
Gene ID: 6078910
Gene Page ID: 5769266
ORF Xenbase ID: 17271633

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054243
Original XGC clone length: 1518

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ839584
dbEST ID: 79657286
Trimmed Sequence: ATGAGCCTTTTGTCACAGCTCTGCCCATTTGCCTTTGGGTGTAATGTCTTCACACTGGGCATCATCTGTACCCTTTGCCTTCTGCTGCTGGATTACATGAAGCGCAGAAAACCCTGCACAAATTTCCCTCCCAGCCCTCCCTCCAGGCCCTTTGTGGGAAATCTGCTGCAGGTGGACTTAAAAAATCTTCACAACAGCATCAAACAGCTCTCTAAACAGTATGGGGATGTGATAAGCCTGCAGCTCTTTTGGAAACCCATGGTGGTGCTCAATGGATTTGAAGTCATGAAGGAGGCCTTGATACAGAAGTCAGAGGACATAGCAGATCGTCCCACAATTTACATATTTGATATCTTTGGGTTTGGTGCAAACAACAGAGGTGTTATGTTTGCAAATTATGGCCAATCTTGGAAGGACCTAAGAAGATTTACTTTGTCTACGTTGAGGGATTTTGGCATGGGGAAAAAATCCCTGGAGGAGAGAGTAGGAGAAGAAGCTGGGTACCTGTGTGCTGCGTTCCAGTCTGAGCAAGGTCGTCCTTTTTACCCAAATGTTTTGCTGAACACAGCAGTTAGTAACATTATCTGCTCTATCATATTTGGGTGAACGGTTTGAATATGATGATCACAAGTTCCAAAAGCTGTTGAGTCTAACTGAAGAGATTTTTATATCTGGATCCGAACAATGCCCCAGGTTTTATGTTTACTTCCTTGGTCAGCTAAATTTCCACCCCTAACCGAGCGGGTTTTTCAACCCTCGGATATCTTTGGAAAAATAACCTAAAAAAAATTTATAATTGAACCACCAACAAAAACTTGA
Full Trace Sequence: CGGGGCCTATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCCTTTTGTCACAGCTCTGCCCATTTGCCTTTGGGTGTAATGTCTTCACACTGGGCATCATCTGTACCCTTTGCCTTCTGCTGCTGGATTACATGAAGCGCAGAAAACCCTGCACAAATTTCCCTCCCAGCCCTCCCTCCAGGCCCTTTGTGGGAAATCTGCTGCAGGTGGACTTAAAAAATCTTCACAACAGCATCAAACAGCTCTCTAAACAGTATGGGGATGTGATAAGCCTGCAGCTCTTTTGGAAACCCATGGTGGTGCTCAATGGATTTGAAGTCATGAAGGAGGCCTTGATACAGAAGTCAGAGGACATAGCAGATCGTCCCACAATTTACATATTTGATATCTTTGGGTTTGGTGCAAACAACAGAGGTGTTATGTTTGCAAATTATGGCCAATCTTGGAAGGACCTAAGAAGATTTACTTTGTCTACGTTGAGGGATTTTGGCATGGGGAAAAAATCCCTGGAGGAGAGAGTAGGAGAAGAAGCTGGGTACCTGTGTGCTGCGTTCCAGTCTGAGCAAGGTCGTCCTTTTTACCCAAATGTTTTGCTGAACACAGCAGTTAGTAACATTATCTGCTCTATCATATTTGGGTGAACGGTTTGAATATGATGATCACAAGTTCCAAAAGCTGTTGAGTCTAACTGAAGAGATTTTTATATCTGGATCCGAACAATGCCCCAGGTTTTATGTTTACTTCCTTGGTCAGCTAAATTTCCACCCCTAACCGAGCGGGTTTTTCAACCCTCGGATATCTTTGGAAAAATAACCTAAAAAAAATTTATAATTGAACCACCAACAAAAACTTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCTTTTGTCACAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839583
dbEST ID: 79657285
Trimmed Sequence: TCTAACCTTGGCACAGATTTTATAATCATGTGGGATCTGATTGTATACAATTACAGGATCTTCCCGTGGGCTCGGCTCGCCATCAGGAATCTGAAATGAGAAGTGCTGCAGGAGAGACGTGAAGAAGAGGAACAGAGTCATCCTGGCCAGCTGCTCTCCTAGACAAACACGGCGACCTGCAGAGAATGCCATAAATGCTTCTCTTTTCACAAACTTGCCATCCCTATCAAGAAAATGTTCCGGATAAAACTGAAAAGGCTTTTCCCAGACTCTCTCATCTTTAAGCACAGATGACAGATTGGTCATAATAAGGATGCCTTTTGGGATGAAGAAGCCTTTGATATATGTGTCTCTGTATGTCACATGTGGCACAGAGAGAGGGATTATATCTGCGTAACGCTGGATTTCATGGATTACGGCATTGGTATAAGGCATCTGTGACACATCTCCCATAGTCGGCTTCCTGGTTCTTCCAATCACTTGGTCAATTTCCGCATTCACCTTTCTTTGCACATCTGGGTACAGTAGCATAAACAGAAGGCCCCATCTCAGGGTTGAGGATGTGGTTTCTGTGCCAGCTGAAAATAAATCAGCTATGGTTAACTGAAGATTCCCCTCATTAAAAATTGCTGTCTTTTACCTGCTTTTTCCTTTTCCATCTCAAGTATAAAGGCCTCCATTAAAATCCCCTGGGGTTCCCCAGAAATCCCTGGGTTTGCCTGAAATGCTCAGTTGAATAATTTTCTTTTAAAAATTTTTTTTTTCCTTAAAATAT
Full Trace Sequence: GAAAAGGGCTATTGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTAACCTTGGCACAGATTTTATAATCATGTGGGATCTGATTGTATACAATTACAGGATCTTCCCGTGGGCTCGGCTCGCCATCAGGAATCTGAAATGAGAAGTGCTGCAGGAGAGACGTGAAGAAGAGGAACAGAGTCATCCTGGCCAGCTGCTCTCCTAGACAAACACGGCGACCTGCAGAGAATGCCATAAATGCTTCTCTTTTCACAAACTTGCCATCCCTATCAAGAAAATGTTCCGGATAAAACTGAAAAGGCTTTTCCCAGACTCTCTCATCTTTAAGCACAGATGACAGATTGGTCATAATAAGGATGCCTTTTGGGATGAAGAAGCCTTTGATATATGTGTCTCTGTATGTCACATGTGGCACAGAGAGAGGGATTATATCTGCGTAACGCTGGATTTCATGGATTACGGCATTGGTATAAGGCATCTGTGACACATCTCCCATAGTCGGCTTCCTGGTTCTTCCAATCACTTGGTCAATTTCCGCATTCACCTTTCTTTGCACATCTGGGTACAGTAGCATAAACAGAAGGCCCCATCTCAGGGTTGAGGATGTGGTTTCTGTGCCAGCTGAAAATAAATCAGCTATGGTTAACTGAAGATTCCCCTCATTAAAAATTGCTGTCTTTTACCTGCTTTTTCCTTTTCCATCTCAAGTATAAAGGCCTCCATTAAAATCCCCTGGGGTTCCCCAGAAATCCCTGGGTTTGCCTGAAATGCTCAGTTGAATAATTTTCTTTTAAAAATTTTTTTTTTCCTTAAAATAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTAACCTTGGCACAGATTTTATA