ORFeome > cyp2j2 ORF1 – XORFeome v1.0

cyp2j2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cyp2j2
Gene ID: 6252918
Gene Page ID: 6032722
ORF Xenbase ID: 17271645

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC124958
Original XGC clone length: 1302

Human orthology & disease relationships

NCBI Entrez ID: 1573
Ensembl gene IDs: ENSG00000134716
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 139300,200950,231300,270200,300000,307030,604229,608902,609535

Library Location

Plate ID: GDExl11083
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ837415
dbEST ID: 79655117
Trimmed Sequence: ATGGCTAAATCATATGGGGATATCTACACTTTATGGCTGGGCCACACCCCTCTTGTAGTGCTGAGCGGGTGCAAATCTGTAAGGAATGGCCTCATCTCCCACTCTGAGGAGCTCTCAGGACGCCCAGTTGACAGCTTTTTACAGGCTCTCACAAATGAAAGAGGTATTGTATCTACTAATGGCCACACCTGGAAACAGCAAAGGCGATTTGGAATGATGACTTTAAGGAACCTGGGACTTGGGAAACGTGGACTGGAATCCAGGATCCAAGAAGAGGCTCAGTGTCTGGTGAAGTCCTTAGCAGCCAAAAACGGAGAGCCAGTTAACCCTTCGGATCTCATTGTCCATGCAGTGGCAAATGTAATTTCTGCTGTGGTATTTGGGCACCGTTTCTCTATAGAAGATCCCACATTCCAGGAAATGGTTCGGTGCAACAACTGTTTGGTTACAAACATGGGCACAGCCTGGGGAAGGATGTATGATGCTTTTCCTTGGCTGATGCAATATGTACCAGGTCCACATCATAGCTGCTTTGCTGCTATGGATTATCTGGCATCATTTATAAAGAAGGAAGTAAAGTTGCATGAATTAAACGACTCAGACGAGGAACCTCAAGATATTATTGATTACTACTTGGCACAGATTGCCAAAACCAACAAGAACCAGACAGCACATTTGATGAAGCAACATGATTAATGTGGTGACTGATCTGGTTGTAACTGGCACAGAAACTTACACCATTACTCCTTCGTGGGCTTTTCCAAAACCTGGGTGCCTTTTCCCTGAAATAACAAAAAAAGGTAAAAAAA
Full Trace Sequence: CGGGGGCCCACATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTAAATCATATGGGGATATCTACACTTTATGGCTGGGCCACACCCCTCTTGTAGTGCTGAGCGGGTGCAAATCTGTAAGGAATGGCCTCATCTCCCACTCTGAGGAGCTCTCAGGACGCCCAGTTGACAGCTTTTTACAGGCTCTCACAAATGAAAGAGGTATTGTATCTACTAATGGCCACACCTGGAAACAGCAAAGGCGATTTGGAATGATGACTTTAAGGAACCTGGGACTTGGGAAACGTGGACTGGAATCCAGGATCCAAGAAGAGGCTCAGTGTCTGGTGAAGTCCTTAGCAGCCAAAAACGGAGAGCCAGTTAACCCTTCGGATCTCATTGTCCATGCAGTGGCAAATGTAATTTCTGCTGTGGTATTTGGGCACCGTTTCTCTATAGAAGATCCCACATTCCAGGAAATGGTTCGGTGCAACAACTGTTTGGTTACAAACATGGGCACAGCCTGGGGAAGGATGTATGATGCTTTTCCTTGGCTGATGCAATATGTACCAGGTCCACATCATAGCTGCTTTGCTGCTATGGATTATCTGGCATCATTTATAAAGAAGGAAGTAAAGTTGCATGAATTAAACGACTCAGACGAGGAACCTCAAGATATTATTGATTACTACTTGGCACAGATTGCCAAAACCAACAAGAACCAGACAGCACATTTGATGAAGCAACATGATTAATGTGGTGACTGATCTGGTTGTAACTGGCACAGAAACTTACACCATTACTCCTTCGTGGGCTTTTCCAAAACCTGGGTGCCTTTTCCCTGAAATAACAAAAAAAGGTAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTAAATCATATGGGGATATC

Sequences - 3ʹ (reverse) EST

Accession: JZ837414
dbEST ID: 79655116
Trimmed Sequence: ACGGGGGATAGCACAGATTTCATAGGGATGAGGCTGCAGTGTCATCTTAAAAACATATTTTGTGTTGACTTCTGTTACACCTTTTGGCAGTTCAATGTTGAATCTGCGAAGAAGAGTGGTGAAGAATATGAACAGCTCAAAGCGGGCCAGTTGTTCTCCCAAACATACCCTGTGTCCTGCAGAGAATGGCAGAAATGCCTCATTCATACGAAAGTTTCCATTTTTGTCCAAAAAGTGGTTAGGGTTGAACTTGTAAGGGGTCTCCCACTGGTGCTGATCATGCAGTACAAAGTCCAGGTTTGGCAGGACCAGTGTATTCTTCTCCGGCTTGTATCCGTTGACTGGAGCTTTCCTTATACAACTTCTATGAATTCGCACAGAGTGCGTGTTCCCGTAACGCTGAGCCTCAAGGAGGGGTACAGTGGGGAAGGGAAGGGTTTTCTTTTCTGCGTATAAAGCAACTGAGAGACGACGAAACAAAAACTTGCTCTTCTTTATGGGGGTTTTTGTTTGGGTTATAGCGGCAAGGGTTGCGGGGGGGGGAAACCAGTGGACCAGGGAGGGGCGGTTTCCTCGTGGATAGCGAAACCCCAAACACCACCCGGCCTAAATACCTGGGGGCGCAGGAAGGGGGGGCGGGGGGGTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAAATGAAAAGAAAATCAAGGGGGTCCTCTTTTGTTTTTGCTTTTGTGTTCCTGGTCGTTGTGCGCGGTTGGCGTTTTCAG
Full Trace Sequence: GAACTGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGGGGGATAGCACAGATTTCATAGGGATGAGGCTGCAGTGTCATCTTAAAAACATATTTTGTGTTGACTTCTGTTACACCTTTTGGCAGTTCAATGTTGAATCTGCGAAGAAGAGTGGTGAAGAATATGAACAGCTCAAAGCGGGCCAGTTGTTCTCCCAAACATACCCTGTGTCCTGCAGAGAATGGCAGAAATGCCTCATTCATACGAAAGTTTCCATTTTTGTCCAAAAAGTGGTTAGGGTTGAACTTGTAAGGGGTCTCCCACTGGTGCTGATCATGCAGTACAAAGTCCAGGTTTGGCAGGACCAGTGTATTCTTCTCCGGCTTGTATCCGTTGACTGGAGCTTTCCTTATACAACTTCTATGAATTCGCACAGAGTGCGTGTTCCCGTAACGCTGAGCCTCAAGGAGGGGTACAGTGGGGAAGGGAAGGGTTTTCTTTTCTGCGTATAAAGCAACTGAGAGACGACGAAACAAAAACTTGCTCTTCTTTATGGGGGTTTTTGTTTGGGTTATAGCGGCAAGGGTTGCGGGGGGGGGAAACCAGTGGACCAGGGAGGGGCGGTTTCCTCGTGGATAGCGAAACCCCAAACACCACCCGGCCTAAATACCTGGGGGCGCAGGAAGGGGGGGCGGGGGGGTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAAATGAAAAGAAAATCAAGGGGGTCCTCTTTTGTTTTTGCTTTTGTGTTCCTGGTCGTTGTGCGCGGTTGGCGTTTTCAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGGGGGATAGCACAGA