ORFeome > cyp39a1 ORF1 – XORFeome v1.0

cyp39a1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cyp39a1
Gene ID: 945549
Gene Page ID: 945545
ORF Xenbase ID: 17271651

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128906
Original XGC clone length: 1440

Human orthology & disease relationships

NCBI Entrez ID: 51302
Ensembl gene IDs: ENSG00000146233
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 105830,139300,140350,146300,200950,203100,203500,227650,230350,231300,241500,241510,264600,268300,270200,270400,276710,300000,307030,600121,604229,606952,607330,608643,608902,609535

Library Location

Plate ID: GDExl11086
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ837814
dbEST ID: 79655516
Trimmed Sequence: ATGGAGCAGATCGCTAGCGTTTCCGCGCAGTTCTCCCCGACCGCCGCGCTAGGGCTGCTGGTGGCGCTGCTGACCGCCGTGTTGGTGCGGTACCTTCTGCCTAATGCCTCCCACAAGCCGCCCTACCCTCCCTGTATCCGAGGCTGGATCCCCTGGTTCGGCGCTGCCTTTGAGATGGGGAAAGCGCCCCTGGAATTCATCGCAAGAGCCAAGGAGAAGCACGGCCCCGTGTTCACAGTGCTGGCAGCAGGGAACAGGCTTACATTTCTCAATGGAAAGGAAGGAGTATCTGCATTTTTCTCTTCTAAAGACGCAGACTTCCAGCAAGCTGTACAGAAACCTGTTCAACATACAGCTTCAATAAACAAGGCGGACTTCATGAAGAGCCACTCCTCCATTCATGAGACGATGAAGCTCCGCTTGTCACAGAACAGGCTGAATCTCTACTTTGACCGGATACGGAATGAGTTCGGCACACGGATAGAACTACTGGACCCAAAAGGGACTGAAGACCTTTTTTACCTTGGTAAAACAAGTCATGGTATCCGCCGGTGGTCGATACATTGTTTGGCAAGGGCTTGGGTCCCACTGGGGAAAGAACACCTGAAAAAATTTTGCTGAACCTTTCCTGGAGTTTTGACGAAAGGCTTTTAGTTTGGGCTCCCATCCTGCGGAATTTCCCCTTGGGAAAAATGGGTCCCCGTCCCAAGCCATGGCCAACAAATTCTGTTTTAAGGAATATTTGTTAATAAAAAGCCAAAAAAGTAAAACAAATCCCTTTTTAAAAGGGAAAAAATTCAAAAAAAAAATTTTGGCAT
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGATCGCTAGCGTTTCCGCGCAGTTCTCCCCGACCGCCGCGCTAGGGCTGCTGGTGGCGCTGCTGACCGCCGTGTTGGTGCGGTACCTTCTGCCTAATGCCTCCCACAAGCCGCCCTACCCTCCCTGTATCCGAGGCTGGATCCCCTGGTTCGGCGCTGCCTTTGAGATGGGGAAAGCGCCCCTGGAATTCATCGCAAGAGCCAAGGAGAAGCACGGCCCCGTGTTCACAGTGCTGGCAGCAGGGAACAGGCTTACATTTCTCAATGGAAAGGAAGGAGTATCTGCATTTTTCTCTTCTAAAGACGCAGACTTCCAGCAAGCTGTACAGAAACCTGTTCAACATACAGCTTCAATAAACAAGGCGGACTTCATGAAGAGCCACTCCTCCATTCATGAGACGATGAAGCTCCGCTTGTCACAGAACAGGCTGAATCTCTACTTTGACCGGATACGGAATGAGTTCGGCACACGGATAGAACTACTGGACCCAAAAGGGACTGAAGACCTTTTTTACCTTGGTAAAACAAGTCATGGTATCCGCCGGTGGTCGATACATTGTTTGGCAAGGGCTTGGGTCCCACTGGGGAAAGAACACCTGAAAAAATTTTGCTGAACCTTTCCTGGAGTTTTGACGAAAGGCTTTTAGTTTGGGCTCCCATCCTGCGGAATTTCCCCTTGGGAAAAATGGGTCCCCGTCCCAAGCCATGGCCAACAAATTCTGTTTTAAGGAATATTTGTTAATAAAAAGCCAAAAAAGTAAAACAAATCCCTTTTTAAAAGGGAAAAAATTCAAAAAAAAAATTTTGGCAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGATCGCTAGCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837813
dbEST ID: 79655515
Trimmed Sequence: TTTTCTCTGCTTGTATCGAACATAGCACGGTCCATCAGGCTGCTGAGTTCCCACTAAGTGAAGATTGCTCTGTTTTGGAAGCGGGTCCAGGAGGCTAAATTCATACTTGTAGAGCATCATCACGACGAGCATGTGCATTTCCATCAGGGCAAACCATCTTCCCGGACACTGATACTTCCCTCCGCCAAAGGCCACGAAACCCTCCAAGAAAACATTCTTCTCTAAATTTGCTTTGCTCCAACGTTCAGGCCGAAACATTTCTGGTTCAGGAAACAGCACTGGGTCTCGGTGGAGCCAATAAGGCGACAGCATCAGGAGGTCTCCAGCCGGAATCATGTAATTATAAATCTTCAGTGGCTGCACAGCTTTCCTGGTGATGGCTCCGGGAGATCTCAGCCGTATGGCCTCCAGTACGCAGTTTTTGATAAACGGAAGCCTTTTCAGCTCAGCTTCATTTATATTTAATGGACTGTTACCTGTTTTACCAAATACAGAGTATATTTCATCCATGGCAGTCTTGTACACTAGCGGATCTGAAATAATGAAGGCAAGTGTCCAAAAGGTTACCGGATTGGCGTTGGCTTGAGATGCCCAGAGAAGCAGCAGACTGTTGTTGTAGGTGGCGATTCCTTTGAGTGTGTCCAGTACGTGCTGATGCAATGTCTTTGATGTCTCCTCTAAAGGATTGTTCATCTCTGCTTCTATTACGATTTTCTTGAACAGACTTATTAGCCATTGTTTGGACTGGGACCAGTCTCTCAAGAGGAACTCCGGCAACTGAGAGCCTTACTCAAACCCTCGTCAAAACTTCCGAAATGCTCAGCAAACTCTTTCAAGGTTGTCCTTCCCAGTGGGACACAACCCCTTGCCAAACAATGTATCAACCCACCCCTGGAAACATGAACTTGCTTTACCCAAGTAAAAAGGTCTTCAATCCCCTCTTGGGTCCCATTAATTCCTATCCGTGTGCCCAAACCTCATCCCTTAATCCGGTCAAAAAATAAAAAATCCAACCCCGGTTCTGTGAACAAGGCGAAATCTTCCTTCCCCCTAAGTGAAAGGGAAGAGAAAGGGCCCCTTCCAGGGAAAATCCCCCCCTGTGGTTTATATTGAAAACCCCGTATTAGTTTTTAAAAAAAGGGTTTTTCTTTGTGTAACACATCTTGTTCCTGTGGGGAAAAAATTTCTTCGCGGGGTCTTTTTTTTTTTATAAAAAAAAGAAAAAAAAAAA
Full Trace Sequence: GGGGAAAACAGGCTATGGACCATGTAATACGACTCACTATNAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTCTCTGCTTGTATCGAACATAGCACGGTCCATCAGGCTGCTGAGTTCCCACTAAGTGAAGATTGCTCTGTTTTGGAAGCGGGTCCAGGAGGCTAAATTCATACTTGTAGAGCATCATCACGACGAGCATGTGCATTTCCATCAGGGCAAACCATCTTCCCGGACACTGATACTTCCCTCCGCCAAAGGCCACGAAACCCTCCAAGAAAACATTCTTCTCTAAATTTGCTTTGCTCCAACGTTCAGGCCGAAACATTTCTGGTTCAGGAAACAGCACTGGGTCTCGGTGGAGCCAATAAGGCGACAGCATCAGGAGGTCTCCAGCCGGAATCATGTAATTATAAATCTTCAGTGGCTGCACAGCTTTCCTGGTGATGGCTCCGGGAGATCTCAGCCGTATGGCCTCCAGTACGCAGTTTTTGATAAACGGAAGCCTTTTCAGCTCAGCTTCATTTATATTTAATGGACTGTTACCTGTTTTACCAAATACAGAGTATATTTCATCCATGGCAGTCTTGTACACTAGCGGATCTGAAATAATGAAGGCAAGTGTCCAAAAGGTTACCGGATTGGCGTTGGCTTGAGATGCCCAGAGAAGCAGCAGACTGTTGTTGTAGGTGGCGATTCCTTTGAGTGTGTCCAGTACGTGCTGATGCAATGTCTTTGATGTCTCCTCTAAAGGATTGTTCATCTCTGCTTCTATTACGATTTTCTTGAACAGACTTATTAGCCATTGTTTGGACTGGGACCAGTCTCTCAAGAGGAACTCCGGCAACTGAGAGCCTTACTCAAACCCTCGTCAAAACTTCCGAAATGCTCAGCAAACTCTTTCAAGGTTGTCCTTCCCAGTGGGACACAACCCCTTGCCAAACAATGTATCAACCCACCCCTGGAAACATGAACTTGCTTTACCCAAGTAAAAAGGTCTTCAATCCCCTCTTGGGTCCCATTAATTCCTATCCGTGTGCCCAAACCTCATCCCTTAATCCGGTCAAAAAATAAAAAATCCAACCCCGGTTCTGTGAACAAGGCGAAATCTTCCTTCCCCCTAAGTGAAAGGGAAGAGAAAGGGCCCCTTCCAGGGAAAATCCCCCCCTGTGGTTTATATTGAAAACCCCGTATTAGTTTTTAAAAAAAGGGTTTTTCTTTGTGTAACACATCTTGTTCCTGTGGGGAAAAAATTTCTTCGCGGGGTCTTTTTTTTTTTATAAAAAAAAGAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTCTCTGCTTGTATCGAACATA