ORFeome > cyp8b1 ORF1 – XORFeome v1.0

cyp8b1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cyp8b1
Gene ID: 1007351
Gene Page ID: 1007347
ORF Xenbase ID: 17271687

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054247
Original XGC clone length: 882

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ839537
dbEST ID: 79657239
Trimmed Sequence: ATGGCTCTGTTTTTTCCAATCATTTTGGCGCTGCTGGCCTCGGTTATCGGTGGCCTCTACCTGCTGGGAATGTTTCGTAAAAGGAGATCCGACGAGCCTCCGTTGGACAAAGGCACAATACCGTGGCTTGGATACGCTCTAGATTTCAGAAAGAGTACGTCAAATTTTTTGCAGAAGATGCACAAGAAACACGGAGACATCTTCACAGTACAGATTGCTGGTTATTATTTTACATTTGTAATGGATCCTTTGTCTTTTGGTCCCATTATAAAGGAATCCAAAGCAAACTTGGATTTTGAGGAATTTGCTAGAGAATTGGTGTCAAGGGTCTTTGGATACCAGTCAGTCACTCATGGTCACAAAATGCTGGAAAAGTCAAGTACAAAGCATCTGATGGGCGATGGTCTGGTAGTCATGACCCAAGCTATGATGGAAAACCTGCAGAATCTTATGGTTCACAACATCGGTAGTAGTAAAGGTGAGAGAGAATGGCACCAGGATGGGTTATTTAACTACAGCTACAATGTTGTCTTCCGTGCCGGTTACCTTGCATTGTATGGTAATGAGCCAGCCAAGAACAAGGGTAAAGAGAAGGCCAAAGAGTTTGATCGCACGCATTCTGATGAGTTGTTTTATGAGTTCGGGAAGTACGACCAGTTATTCCCCCCTCTGGCCTACTCAGTTTTACCTCCCAAAGACAAGATTGAAACTGAAAAGTTAAAAAAGGTTGTTTTTGAACATGGTTATCTTGTAAGAAAAACCCTCCAAAAAGAAAACATCCAGTGGTTTGGATTGGTGAAACAACATCCACCAAAGGGGCAAAACAAGGAAAGGC
Full Trace Sequence: GGCCCCAAATAATAGATTTTANTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCTGTTTTTTCCAATCATTTTGGCGCTGCTGGCCTCGGTTATCGGTGGCCTCTACCTGCTGGGAATGTTTCGTAAAAGGAGATCCGACGAGCCTCCGTTGGACAAAGGCACAATACCGTGGCTTGGATACGCTCTAGATTTCAGAAAGAGTACGTCAAATTTTTTGCAGAAGATGCACAAGAAACACGGAGACATCTTCACAGTACAGATTGCTGGTTATTATTTTACATTTGTAATGGATCCTTTGTCTTTTGGTCCCATTATAAAGGAATCCAAAGCAAACTTGGATTTTGAGGAATTTGCTAGAGAATTGGTGTCAAGGGTCTTTGGATACCAGTCAGTCACTCATGGTCACAAAATGCTGGAAAAGTCAAGTACAAAGCATCTGATGGGCGATGGTCTGGTAGTCATGACCCAAGCTATGATGGAAAACCTGCAGAATCTTATGGTTCACAACATCGGTAGTAGTAAAGGTGAGAGAGAATGGCACCAGGATGGGTTATTTAACTACAGCTACAATGTTGTCTTCCGTGCCGGTTACCTTGCATTGTATGGTAATGAGCCAGCCAAGAACAAGGGTAAAGAGAAGGCCAAAGAGTTTGATCGCACGCATTCTGATGAGTTGTTTTATGAGTTCGGGAAGTACGACCAGTTATTCCCCCCTCTGGCCTACTCAGTTTTACCTCCCAAAGACAAGATTGAAACTGAAAAGTTAAAAAAGGTTGTTTTTGAACATGGTTATCTTGTAAGAAAAACCCTCCAAAAAGAAAACATCCAGTGGTTTGGATTGGTGAAACAACATCCACCAAAGGGGCAAAACAAGGAAAGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCTGTTTTTTCCAATCATT

Sequences - 3ʹ (reverse) EST

Accession: JZ839536
dbEST ID: 79657238
Trimmed Sequence: CCCTGAGATGCCCACAGGAGCAAAAAACATAAACCTATCTTGCATGTGTTCTGGCATTCCTTGCTCTGCCCTCTGCTGATGTTGCTCACCAATCCAACCACTGATGTTTTCTTTTTGGAGGGTTTTCTTTACAGATAACATGTTCCAAAACAACCTCTTTAACCTCTCAGCTTCAATCTTGTCTTTGGGAGGTAAAACTGAGTAGGCCAGACGGGGGAATAACTGGTCGTACTTCCGGAACTCATAAAACAACTCATCAGAATGCGTGCGATCAAACTCTTTGGCCTTCTCTTTACCCTTGTTCTTGGCTGGCTCATTACCATACAATGCAAGGTAACCGGCACGGAAGACAACATTGTAGCTGTAGTTAAATAACCCATCCTGGTGCCATTCTCTCTCACCTTTACTACTACCGATGTTGTGAACCATAAGATTCTGCAGGTTTTCCATCATAGCTTGGGTCATGACTACCACACCATCGCCCATCAGATGCTTTGTACTTGACTTTTCCAGCATTTTGTGACCATGAGTGACTGACTGGTATCCAAAGACCCTTGACACCAAATTCTCTACCAATTCCTCAAAATCAAAGTTTGCTTTGGATTCCTTTATAATGGGACCAAAAGAACAAGGAATCCTTACAAATGTAAAATAAATAACAACAATCTTTACTGTAAAAAAGTCCTCTGTGTTCCTGTGTCTCCTTCCGCAAAAAAATTTAAAGTAACTCCTTTCGAAAATCTTAAAAGGTAATCCCTCTCCCACT
Full Trace Sequence: GGGAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCCTGAGATGCCCACAGGAGCAAAAAACATAAACCTATCTTGCATGTGTTCTGGCATTCCTTGCTCTGCCCTCTGCTGATGTTGCTCACCAATCCAACCACTGATGTTTTCTTTTTGGAGGGTTTTCTTTACAGATAACATGTTCCAAAACAACCTCTTTAACCTCTCAGCTTCAATCTTGTCTTTGGGAGGTAAAACTGAGTAGGCCAGACGGGGGAATAACTGGTCGTACTTCCGGAACTCATAAAACAACTCATCAGAATGCGTGCGATCAAACTCTTTGGCCTTCTCTTTACCCTTGTTCTTGGCTGGCTCATTACCATACAATGCAAGGTAACCGGCACGGAAGACAACATTGTAGCTGTAGTTAAATAACCCATCCTGGTGCCATTCTCTCTCACCTTTACTACTACCGATGTTGTGAACCATAAGATTCTGCAGGTTTTCCATCATAGCTTGGGTCATGACTACCACACCATCGCCCATCAGATGCTTTGTACTTGACTTTTCCAGCATTTTGTGACCATGAGTGACTGACTGGTATCCAAAGACCCTTGACACCAAATTCTCTACCAATTCCTCAAAATCAAAGTTTGCTTTGGATTCCTTTATAATGGGACCAAAAGAACAAGGAATCCTTACAAATGTAAAATAAATAACAACAATCTTTACTGTAAAAAAGTCCTCTGTGTTCCTGTGTCTCCTTCCGCAAAAAAATTTAAAGTAACTCCTTTCGAAAATCTTAAAAGGTAATCCCTCTCCCACT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCCTGAGATGCCCACAGGA