ORFeome > cypxl301-a ORF1 – XORFeome v1.0

cypxl301-a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 980017
Gene Page ID: 980013
ORF Xenbase ID: 17271693

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC129578
Original XGC clone length: 1548

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ838723
dbEST ID: 79656425
Trimmed Sequence: ATGGCTTCCAATCTGTGGGAAGTGCTGAGTTCCCCCGGGCTGTTTGGGAACATTTACCAGTTTGGTCAGTTTGCTGCACAGCTGTGCCTGGTTCTGCTGCTGCTGAAAGCCTGGGGTTTATTTATCAGGTGGAAAAGTCTCAAGGATGCATTGCAGAATTTTCCTGGTCCCCCCAAACACTGGTTATATGGGCACGCCAATCAGTTCCGAGGAGATGGGACAGATATGGACAGGGTTCTCGCATGGGCAGATAAATATCCTAAAGCATTTCCAATGTGGGTTGGACAATTCTTCGCCAACCTCATCATTACTAACCCGGAGTATGCAAAAGCTGTGTTTGCCAGATCAGATCCTAAAACACCAACTGGGTACAATTTTCTTATCCCATGGATTGGAAAAGGCTTGCTTGTCCTCTCAGGAGATAAGTGGTTCCAGCACCGCAAGCTTCTCACTCCAGGATTTCACTATGACGTTCTGAAACCTTATGTCAGACTGATTTCAGATTCTACAAATGTCATGCTGGATAAATGGGTTTCATTTTCCAATAAAGGTGAAACGGTGGAGCTTGTCCATCATGTCAGCCGGATGACCCTGAACAGCATCATGAACTGTGCCTTCGTCTACCATATCAACTGGCAGACTGATAAAAATAATTCATACACAAACAGCGGTTTATGATCTTCTCCTTTTCTGCTTATGGGGGGGCCCCTTAGTGTTTCCTTATTCTTTTTTT
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTCCAATCTGTGGGAAGTGCTGAGTTCCCCCGGGCTGTTTGGGAACATTTACCAGTTTGGTCAGTTTGCTGCACAGCTGTGCCTGGTTCTGCTGCTGCTGAAAGCCTGGGGTTTATTTATCAGGTGGAAAAGTCTCAAGGATGCATTGCAGAATTTTCCTGGTCCCCCCAAACACTGGTTATATGGGCACGCCAATCAGTTCCGAGGAGATGGGACAGATATGGACAGGGTTCTCGCATGGGCAGATAAATATCCTAAAGCATTTCCAATGTGGGTTGGACAATTCTTCGCCAACCTCATCATTACTAACCCGGAGTATGCAAAAGCTGTGTTTGCCAGATCAGATCCTAAAACACCAACTGGGTACAATTTTCTTATCCCATGGATTGGAAAAGGCTTGCTTGTCCTCTCAGGAGATAAGTGGTTCCAGCACCGCAAGCTTCTCACTCCAGGATTTCACTATGACGTTCTGAAACCTTATGTCAGACTGATTTCAGATTCTACAAATGTCATGCTGGATAAATGGGTTTCATTTTCCAATAAAGGTGAAACGGTGGAGCTTGTCCATCATGTCAGCCGGATGACCCTGAACAGCATCATGAACTGTGCCTTCGTCTACCATATCAACTGGCAGACTGATAAAAATAATTCATACACAAACAGCGGTTTATGATCTTCTCCTTTTCTGCTTATGGGGGGGCCCCTTAGTGTTTCCTTATTCTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCCAATCTGTGGGAAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838722
dbEST ID: 79656424
Trimmed Sequence: GCTTGCTTTCTTTAGGTACACGTGGATGCCATTTTTGGAGCGCAGAACAAGTTGTGGTGATTTCAGGGGCGGTTTTGATAGATGCGGGGATAATTCATAACGGTTTAACGTTAGAGCCACAGCCACTTTCAGTTCATTCATAGCAAAGTTCTGTCCAATGCAGTTTCTTGGTCCAGCAGCAAAAGGAACAAAAGCATGGGAGTGACGCTTTGAAGAGTTTTCTGAGGAAAACCGGAGTGGATCAAACACCTCTGGATCTTTCCAAACACTGGGATTCCGATGAATGCAGAAAATATTTATGAAAATTACGGAGCCAGCAGGTAAGGACCGTCCATCATAAAATGTAATTGGTTTGTTTAGTTCCCTAGATACACCTGGGACTGGAGGATAAAGGCGGAGACTCTCCTTGATGCACATTGTGGTGTANGGGGATTTTGCTAAGATGCTCCCATTCAAAAGAATCCTTCTCACCAAGTACTTCCCTGATCTCCTCCCGGCATTTCTGCTGGTGCTCTGGGTATTTGGCCATGCAGTATAGAATCCAGGAAATGCCACTGGCTGTTGTGTCATGGCCTTCCAACATAAATGTGTCCACCTCCTGCACGGAGGTCCTCATCACATAAACCCTTCCCAATTTCATCCCTGCCCCAAAGAAAGAAATACAAAAAAGCCCGGGTTGCCCCTTCTGGCGTGACCCTCCTCCAACTCCCCCTCCTTCCCTTACCCACTGTTTTTTCTTCTGTTTAGAAAAACCTGAAGGAGGAGAGGGGGGAG
Full Trace Sequence: GGAAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTTGCTTTCTTTAGGTACACGTGGATGCCATTTTTGGAGCGCAGAACAAGTTGTGGTGATTTCAGGGGCGGTTTTGATAGATGCGGGGATAATTCATAACGGTTTAACGTTAGAGCCACAGCCACTTTCAGTTCATTCATAGCAAAGTTCTGTCCAATGCAGTTTCTTGGTCCAGCAGCAAAAGGAACAAAAGCATGGGAGTGACGCTTTGAAGAGTTTTCTGAGGAAAACCGGAGTGGATCAAACACCTCTGGATCTTTCCAAACACTGGGATTCCGATGAATGCAGAAAATATTTATGAAAATTACGGAGCCAGCAGGTAAGGACCGTCCATCATAAAATGTAATTGGTTTGTTTAGTTCCCTAGATACACCTGGGACTGGAGGATAAAGGCGGAGACTCTCCTTGATGCACATTGTGGTGTANGGGGATTTTGCTAAGATGCTCCCATTCAAAAGAATCCTTCTCACCAAGTACTTCCCTGATCTCCTCCCGGCATTTCTGCTGGTGCTCTGGGTATTTGGCCATGCAGTATAGAATCCAGGAAATGCCACTGGCTGTTGTGTCATGGCCTTCCAACATAAATGTGTCCACCTCCTGCACGGAGGTCCTCATCACATAAACCCTTCCCAATTTCATCCCTGCCCCAAAGAAAGAAATACAAAAAAGCCCGGGTTGCCCCTTCTGGCGTGACCCTCCTCCAACTCCCCCTCCTTCCCTTACCCACTGTTTTTTCTTCTGTTTAGAAAAACCTGAAGGAGGAGAGGGGGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTGCTTTCTTTAGGTACAC