ORFeome > cyr61 ORF1 – XORFeome v1.0

cyr61 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cyr61
Gene ID: 864894
Gene Page ID: 482633
ORF Xenbase ID: 17271699

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056838
Original XGC clone length: 1128

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ839092
dbEST ID: 79656794
Trimmed Sequence: ATGAGCTTCTTAGCACTTAACCCCGTCCTTGCTATTGCCCTTCTTTCTGGATTCATTGACTTGGCTGTGTCATCGTGCCCAGCAGTGTGCCAATGTCCGGTTGAAGTACCCAAATGTGCCCCAGGAGTTGGACTGGTTCTGGATGGTTGTGGATGTTGCAAAATCTGTGCTAAGCAGCTCAATGAAGATTGCAGCAAAACTCATCCTTGTGATCACACCAAGGGACTTGAATGCAATTTTGGAGCCAGTTCCAGAGCCATTAAGGGAATATGTAGAGCAAAATCAGAAGGGAGACCTTGTGAGTACAATTCCAAAATCTACCAGAATGGAGAAAGTTTTCAGCCAAACTGCAAGCATCAGTGCACATGCATAGATGGAGCTGTTGGTTGCCTTCCATTGTGTCCTCAAGAACTATCCCTGCCTAACTTGGGCTGCCCAAATCCAAGGCTGGTGAAGGTTCCAGGGCAGTGCTGTGAGGAGTGGGTCTGCGATGAAGCCAAAGATCCAGTCGATGAGATGGATGACTTCTTTAACAAAGAATTTGGAATGGATACTAATGAAGGAGAACTTACAAGGAAAAATGAATTTGTTGCGGTCATCAAAGGAGGACTAAAAATGCTGCCTGTTTTTGGCTCTGACCCGCAAAGTCATGTTGTGGAGAACTCAAAGTGCATTGTTCAAACCACATTCGTGGTCTCAGTGCTCAAAAACCTGTGGAACTGGTATCTCTACAAGAAGTCCCAAATAATAACAGCAAACTGCAAAATCCTGAAGGGAGACCAAAAACCTGTTAAAATCCCGACCTTTGGTGCCCAACCCAG
Full Trace Sequence: TCGTGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCTTCTTAGCACTTAACCCCGTCCTTGCTATTGCCCTTCTTTCTGGATTCATTGACTTGGCTGTGTCATCGTGCCCAGCAGTGTGCCAATGTCCGGTTGAAGTACCCAAATGTGCCCCAGGAGTTGGACTGGTTCTGGATGGTTGTGGATGTTGCAAAATCTGTGCTAAGCAGCTCAATGAAGATTGCAGCAAAACTCATCCTTGTGATCACACCAAGGGACTTGAATGCAATTTTGGAGCCAGTTCCAGAGCCATTAAGGGAATATGTAGAGCAAAATCAGAAGGGAGACCTTGTGAGTACAATTCCAAAATCTACCAGAATGGAGAAAGTTTTCAGCCAAACTGCAAGCATCAGTGCACATGCATAGATGGAGCTGTTGGTTGCCTTCCATTGTGTCCTCAAGAACTATCCCTGCCTAACTTGGGCTGCCCAAATCCAAGGCTGGTGAAGGTTCCAGGGCAGTGCTGTGAGGAGTGGGTCTGCGATGAAGCCAAAGATCCAGTCGATGAGATGGATGACTTCTTTAACAAAGAATTTGGAATGGATACTAATGAAGGAGAACTTACAAGGAAAAATGAATTTGTTGCGGTCATCAAAGGAGGACTAAAAATGCTGCCTGTTTTTGGCTCTGACCCGCAAAGTCATGTTGTGGAGAACTCAAAGTGCATTGTTCAAACCACATTCGTGGTCTCAGTGCTCAAAAACCTGTGGAACTGGTATCTCTACAAGAAGTCCCAAATAATAACAGCAAACTGCAAAATCCTGAAGGGAGACCAAAAACCTGTTAAAATCCCGACCTTTGGTGCCCAACCCAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTTCTTAGCACTTAACC

Sequences - 3ʹ (reverse) EST

Accession: JZ839091
dbEST ID: 79656793
Trimmed Sequence: GTCTCTGAATTTGTGGATATCATTGAATAATCTGTAGTAAGGATAGGCTTCATTTGTATGTGGGCAGTTGTAGTTGCATCTACATGACTGGATCATCATGACATTTTTAGTAAAGGTCTCCCCATCCTCACAACGGAATCGGATTTTGACAGTCCTTGTCTGCTGTGGAGTGCAGCACCTCCCATCCACACATGATCCACAATATTTTGGACGATATTTCTTTACACTGGAACATCCGGCGTATGTGTATCTTACTGGAGCTTGAGATTTTTTTGTCTTGGTGCATTTCTTTCCCTTCTTTAAACTTGTATAGCTTGGCTGGCCACAAGGTCGGACTTCACAGATTCTGGTCTCCCTCACGAGTCTGCAGTTGCTGTTATCATTTGTGACTCTCGTAGAGATACCAGTTCCACAGGTCTTTGAGCACTGAGACCACGATGTGGTTTGAACAATGCACTTTGAGTTCTCCACAACATGACTTTGCGGGTCAGAGCCAAAAACAGGCAGCATTTTTAGTCCTCCTTTGATGACCGCAACAAATTCATTTTTCCTTGTAAGTTCTCCTTCATTAGTATCCATTCCAAATTCTTTGTTAAAGAAGTCATCCCTCTCATCGACTGGATCTTTGGCTTCATCGCAGAACCACTCCTCACAACACTGCCCCGGGAACCTTCACCGGCCTTGGATTTGGGCAGCCCAAGTTAGGCCGGGGATAAGTTCTTGGAGGAACCAAAGGGAAGGGCAACCCAAAGAGCTCCCATCATAGGCCAGGTTG
Full Trace Sequence: CGAGAAAATGTCTATGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTCTGAATTTGTGGATATCATTGAATAATCTGTAGTAAGGATAGGCTTCATTTGTATGTGGGCAGTTGTAGTTGCATCTACATGACTGGATCATCATGACATTTTTAGTAAAGGTCTCCCCATCCTCACAACGGAATCGGATTTTGACAGTCCTTGTCTGCTGTGGAGTGCAGCACCTCCCATCCACACATGATCCACAATATTTTGGACGATATTTCTTTACACTGGAACATCCGGCGTATGTGTATCTTACTGGAGCTTGAGATTTTTTTGTCTTGGTGCATTTCTTTCCCTTCTTTAAACTTGTATAGCTTGGCTGGCCACAAGGTCGGACTTCACAGATTCTGGTCTCCCTCACGAGTCTGCAGTTGCTGTTATCATTTGTGACTCTCGTAGAGATACCAGTTCCACAGGTCTTTGAGCACTGAGACCACGATGTGGTTTGAACAATGCACTTTGAGTTCTCCACAACATGACTTTGCGGGTCAGAGCCAAAAACAGGCAGCATTTTTAGTCCTCCTTTGATGACCGCAACAAATTCATTTTTCCTTGTAAGTTCTCCTTCATTAGTATCCATTCCAAATTCTTTGTTAAAGAAGTCATCCCTCTCATCGACTGGATCTTTGGCTTCATCGCAGAACCACTCCTCACAACACTGCCCCGGGAACCTTCACCGGCCTTGGATTTGGGCAGCCCAAGTTAGGCCGGGGATAAGTTCTTGGAGGAACCAAAGGGAAGGGCAACCCAAAGAGCTCCCATCATAGGCCAGGTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTCTGAATTTGTGGATATCATT