ORFeome > cytl1 ORF1 – XORFeome v1.0

cytl1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cytl1
Gene ID: 992523
Gene Page ID: 992521
ORF Xenbase ID: 17271723

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128942
Original XGC clone length: 402

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ837792
dbEST ID: 79655494
Trimmed Sequence: ATGAAGCTTCTGCTGAGCCTCTTAGCACTCAGCCTTCTGTTTCTCTTTGTCTGCTCCGCTCCTCCGACCTGCTATTCCAAGGTCTTCACTATGAGCAAAGAAATCACAGACGCCTTCCAAAGAATACAGAAAACAGCCCCACCTGGACCCTGCCTGGATGCCCTTCCTACTCTCTATCTGGATATACATAACTCCTGCGTGATGAACAAACTGCGTACATTCATTTCAGCTCCGAGGTGTGGGAGGATGCCCAGGGTGGAAGTTCTAAAGAGAAGAGTGCGGAAATTGTACAATATCATGAACTCCGTCTGCAAAAGGGACCTTGTTTTCTTCACTGACGACTGTGCGGCTCTGGAAGTGCCTTTGTCAACATTCCGCCCCATCACGGAACCTTCTAGATT
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGCTTCTGCTGAGCCTCTTAGCACTCAGCCTTCTGTTTCTCTTTGTCTGCTCCGCTCCTCCGACCTGCTATTCCAAGGTCTTCACTATGAGCAAAGAAATCACAGACGCCTTCCAAAGAATACAGAAAACAGCCCCACCTGGACCCTGCCTGGATGCCCTTCCTACTCTCTATCTGGATATACATAACTCCTGCGTGATGAACAAACTGCGTACATTCATTTCAGCTCCGAGGTGTGGGAGGATGCCCAGGGTGGAAGTTCTAAAGAGAAGAGTGCGGAAATTGTACAATATCATGAACTCCGTCTGCAAAAGGGACCTTGTTTTCTTCACTGACGACTGTGCGGCTCTGGAAGTGCCTTTGTCAACATTCCGCCCCATCACGGAACCTTCTAGATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCGAATCTAAACCATGTCAACAAATCTCTAAGGTTACAAAGGCCGCGCTCGACAAAAAGGACAGCTTCTCCGAAAACCAGGGGCGTGGGTGGAACAAAAAGATTGGCAGGAAGAAACCCCAGAACAAGAACAAAACCCGGGGGGCGACCTAAAGGGGGGGAGAAAAGAGCCCGCGCGCGGCGCCCGCCGTCCCCAAAAACGTTACCCCAAGCGCAGGGGGGGAAAACGCGCCCGGGGGGGGGGTTTTTTTTGTGTTTGTGTGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGCTTCTGCTGAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837791
dbEST ID: 79655493
Trimmed Sequence: TCTAGAAGGTTCCGTGATGGGGCGGAATGTTGACAAAGGCACTTCCAGAGCCGCACAGTCGTCAGTGAAGAAAACAAGGTCCCTTTTGCAGACGGAGTTCATGATATTGTACAATTTCCGCACTCTTCTCTTTAGAACTTCCACCCTGGGCATCCTCCCACACCTCGGAGCTGAAATGAATGTACGCAGTTTGTTCATCACGCAGGAGTTATGTATATCCAGATAGAGAGTAGGAAGGGCATCCAGGCAGGGTCCAGGTGGGGCTGTTTTCTGTATTCTTTGGAAGGCGTCTGTGATTTCTTTGCTCATAGTGAAGACCTTGGAATATCAGGTCGGAGGAGCGGAGCAGACAAAGAGAAACAGAAGGCTGAGTGCTAAGAGGCTCAGCAGAAGCTTCATGG
Full Trace Sequence: GGGCAGGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTAGAAGGTTCCGTGATGGGGCGGAATGTTGACAAAGGCACTTCCAGAGCCGCACAGTCGTCAGTGAAGAAAACAAGGTCCCTTTTGCAGACGGAGTTCATGATATTGTACAATTTCCGCACTCTTCTCTTTAGAACTTCCACCCTGGGCATCCTCCCACACCTCGGAGCTGAAATGAATGTACGCAGTTTGTTCATCACGCAGGAGTTATGTATATCCAGATAGAGAGTAGGAAGGGCATCCAGGCAGGGTCCAGGTGGGGCTGTTTTCTGTATTCTTTGGAAGGCGTCTGTGATTTCTTTGCTCATAGTGAAGACCTTGGAATATCAGGTCGGAGGAGCGGAGCAGACAAAGAGAAACAGAAGGCTGAGTGCTAAGAGGCTCAGCAGAAGCTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTGCAACCAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGACTGAAAAAACAAACAAAAAAACTTGACTGAAAAGGCGGCTCTCGCCGGGGCGGGAAAAAATAAAGGCGCTCCAAAAAAACAGCGCTTCCCTTTTTAACCCTCTTTTGGGAAGGAGACCACCCAAAAACAACGAAAACACACGGGGGTGGGTAAAATTTGGGAATCGTTGTCGGGGGGGGGCTCGCCCAAGGGGGAAAAAACTTAAAAAAAAAAAAAGAGGGGGGAGGGGGGGGGGTGTGTTTTTGGTGTGGGTAATATCTGTGTTGTGGGGGGAANANAGANANCCCCGGGAGGCGCCGCAAGAAAAGCGCGGGGGCGCGGGGGGGGGAGAGTGGAATANATGNAGGGGCGGANGAGTGTAGCGGGGANGGGTGGCGGGGNAAGNGGNGAGAAGAGAAGGAAGNGAGGGGAGANGGGGNGGGGGAGGGGAAAANNNGGNNGAANGNAANGGGAGGNNANNNNCGACGCGGNGCGACGAGGAANGGCGNNNNGNGGGNGGGGAGGNGGGGNNGGANGGGGGNNGGGGGNGGAGGNGGNNGNAAGGNGGGGGGAGGGGGGNNTAGNGGNNGNNGGAAAGGGGGGAGGNNAGGGACGAGAAAANNNANAGNNNGAAGGNGNGGGANGGAGGGGAGGGGGCAAGGGGNGNAGAAGGGGCGGGAAAGGNGGAGGGGCGGANGGNGGGGGAAGGGGGGGGGGGAGAAGAGGNGGGGAGAGNGGGGGGGGNGGAGGGGGGGGANN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTAGAAGGTTCCGTGATG